ID: 901977223

View in Genome Browser
Species Human (GRCh38)
Location 1:13004747-13004769
Sequence TCTCTTCCACTGGGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 3, 1: 0, 2: 2, 3: 34, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901977217_901977223 9 Left 901977217 1:13004715-13004737 CCTAGACCTTGCTCAGGTCAGTT 0: 3
1: 0
2: 7
3: 16
4: 153
Right 901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG 0: 3
1: 0
2: 2
3: 34
4: 301
901977218_901977223 3 Left 901977218 1:13004721-13004743 CCTTGCTCAGGTCAGTTCTTTGG 0: 3
1: 0
2: 0
3: 18
4: 203
Right 901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG 0: 3
1: 0
2: 2
3: 34
4: 301
901977216_901977223 10 Left 901977216 1:13004714-13004736 CCCTAGACCTTGCTCAGGTCAGT 0: 3
1: 0
2: 8
3: 15
4: 122
Right 901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG 0: 3
1: 0
2: 2
3: 34
4: 301
901977214_901977223 22 Left 901977214 1:13004702-13004724 CCTAGCTGATGTCCCTAGACCTT 0: 10
1: 5
2: 1
3: 10
4: 115
Right 901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG 0: 3
1: 0
2: 2
3: 34
4: 301
901977213_901977223 23 Left 901977213 1:13004701-13004723 CCCTAGCTGATGTCCCTAGACCT 0: 10
1: 2
2: 4
3: 5
4: 98
Right 901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG 0: 3
1: 0
2: 2
3: 34
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901977223 Original CRISPR TCTCTTCCACTGGGCTCCTG TGG Intronic