ID: 901988013

View in Genome Browser
Species Human (GRCh38)
Location 1:13091441-13091463
Sequence TCTCCTTGCTGCACTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901988004_901988013 25 Left 901988004 1:13091393-13091415 CCTCAATGAGAGGTTTCGCCCAG No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data
901988009_901988013 -9 Left 901988009 1:13091427-13091449 CCACAGATCCCATGTCTCCTTGC No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data
901988007_901988013 -1 Left 901988007 1:13091419-13091441 CCTCCTGTCCACAGATCCCATGT No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data
901988005_901988013 7 Left 901988005 1:13091411-13091433 CCCAGTAGCCTCCTGTCCACAGA No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data
901988008_901988013 -4 Left 901988008 1:13091422-13091444 CCTGTCCACAGATCCCATGTCTC No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data
901988006_901988013 6 Left 901988006 1:13091412-13091434 CCAGTAGCCTCCTGTCCACAGAT No data
Right 901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901988013 Original CRISPR TCTCCTTGCTGCACTCCTGA GGG Intergenic