ID: 901988181

View in Genome Browser
Species Human (GRCh38)
Location 1:13092197-13092219
Sequence TGGGTTTCCCCCCAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901988177_901988181 -10 Left 901988177 1:13092184-13092206 CCTGTTGCTGCTTTGGGTTTCCC No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988172_901988181 19 Left 901988172 1:13092155-13092177 CCGCACGTATTTTTTACCTTCCA No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988169_901988181 29 Left 901988169 1:13092145-13092167 CCCTCCTCTGCCGCACGTATTTT No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988173_901988181 3 Left 901988173 1:13092171-13092193 CCTTCCACTAGTGCCTGTTGCTG No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988174_901988181 -1 Left 901988174 1:13092175-13092197 CCACTAGTGCCTGTTGCTGCTTT No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988168_901988181 30 Left 901988168 1:13092144-13092166 CCCCTCCTCTGCCGCACGTATTT No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988171_901988181 25 Left 901988171 1:13092149-13092171 CCTCTGCCGCACGTATTTTTTAC No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data
901988170_901988181 28 Left 901988170 1:13092146-13092168 CCTCCTCTGCCGCACGTATTTTT No data
Right 901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901988181 Original CRISPR TGGGTTTCCCCCCAGTGGGA GGG Intergenic
No off target data available for this crispr