ID: 901989437

View in Genome Browser
Species Human (GRCh38)
Location 1:13100802-13100824
Sequence CTCAGGGATCTTCCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901989435_901989437 -10 Left 901989435 1:13100789-13100811 CCTTTCTTTTAGACTCAGGGATC No data
Right 901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG No data
901989430_901989437 23 Left 901989430 1:13100756-13100778 CCAAGTCTCTGTCATGGTGCTAT No data
Right 901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901989437 Original CRISPR CTCAGGGATCTTCCCACAGT GGG Intergenic
No off target data available for this crispr