ID: 901993631

View in Genome Browser
Species Human (GRCh38)
Location 1:13134570-13134592
Sequence TGGGTTTCCCCCCAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901993631_901993643 29 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993643 1:13134622-13134644 AAAATACGTGCGGCAGAGGAGGG No data
901993631_901993639 3 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993639 1:13134596-13134618 CAGCAACAGGCACTAGTGGAAGG No data
901993631_901993640 19 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993640 1:13134612-13134634 TGGAAGGTAAAAAATACGTGCGG No data
901993631_901993635 -10 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993635 1:13134583-13134605 GGGAAACCCAAAGCAGCAACAGG No data
901993631_901993644 30 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993644 1:13134623-13134645 AAATACGTGCGGCAGAGGAGGGG No data
901993631_901993638 -1 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993638 1:13134592-13134614 AAAGCAGCAACAGGCACTAGTGG No data
901993631_901993642 28 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993642 1:13134621-13134643 AAAAATACGTGCGGCAGAGGAGG No data
901993631_901993641 25 Left 901993631 1:13134570-13134592 CCCTCCCACTGGGGGGAAACCCA No data
Right 901993641 1:13134618-13134640 GTAAAAAATACGTGCGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901993631 Original CRISPR TGGGTTTCCCCCCAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr