ID: 901993799

View in Genome Browser
Species Human (GRCh38)
Location 1:13135326-13135348
Sequence TCTCCTTGCTGCACTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901993799_901993806 6 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993806 1:13135355-13135377 ATCTGTGGACAGGAGGCTACTGG No data
901993799_901993804 -4 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993804 1:13135345-13135367 GAGACATGGGATCTGTGGACAGG No data
901993799_901993805 -1 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993805 1:13135348-13135370 ACATGGGATCTGTGGACAGGAGG No data
901993799_901993807 7 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993807 1:13135356-13135378 TCTGTGGACAGGAGGCTACTGGG No data
901993799_901993803 -9 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993803 1:13135340-13135362 GCAAGGAGACATGGGATCTGTGG No data
901993799_901993808 25 Left 901993799 1:13135326-13135348 CCCTCAGGAGTGCAGCAAGGAGA No data
Right 901993808 1:13135374-13135396 CTGGGCGAAACCTCTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901993799 Original CRISPR TCTCCTTGCTGCACTCCTGA GGG (reversed) Intergenic