ID: 901994046

View in Genome Browser
Species Human (GRCh38)
Location 1:13137012-13137034
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 4, 1: 11, 2: 16, 3: 38, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901994044_901994046 2 Left 901994044 1:13136987-13137009 CCTTCAGCTGTACGTAGACTGGT No data
Right 901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG 0: 4
1: 11
2: 16
3: 38
4: 218
901994042_901994046 8 Left 901994042 1:13136981-13137003 CCTCAACCTTCAGCTGTACGTAG No data
Right 901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG 0: 4
1: 11
2: 16
3: 38
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900913601 1:5619214-5619236 GTTGCTGGAGCCACCAGAGCTGG - Intergenic
901044515 1:6387668-6387690 ACTTCTGGTCTGACCAGAACTGG + Intronic
901421150 1:9152008-9152030 GCTACTGGAGAGGCCAGGGCAGG + Intergenic
901475602 1:9487172-9487194 GATGCTGGAGTGACCGGAGGAGG - Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901766109 1:11501168-11501190 GCTTCTGGAGTACCCTGGGCTGG + Exonic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
903216742 1:21847627-21847649 TCTCCTGGGGTGAGCAGAGCAGG - Intronic
903469739 1:23577852-23577874 GCTTCTAGAATGACCAGCCCAGG - Intergenic
904288109 1:29466555-29466577 GTTTCTGTGGTGACTAGAGCAGG - Intergenic
905022108 1:34825257-34825279 GCTTTTGGAGGCAGCAGAGCTGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905444560 1:38017870-38017892 GCACCTGGAGTAACCAGAGAAGG - Intronic
907249057 1:53125836-53125858 GCTTCTGGTGTAAACAGAGCTGG - Intronic
907326344 1:53640956-53640978 GCCTCTGGAGGGAACAGAACCGG + Intronic
915708183 1:157867206-157867228 TATTCTGGAGTAACCAGAACAGG + Intronic
919827911 1:201516895-201516917 GCTCCTGGAGTGGCCAGGTCAGG - Intergenic
921045186 1:211471483-211471505 TCCTCTGGAGTGTCCAGACCTGG - Intergenic
921075207 1:211695107-211695129 GCTTCTGGATGGTCCAGAGGGGG - Intergenic
923521890 1:234741303-234741325 GCTTCTGTAGGGTCCCGAGCAGG + Intergenic
923677848 1:236095783-236095805 GGTTCTGGGGTGACTAGGGCAGG - Intergenic
923898668 1:238301856-238301878 ACTTCTGGGGTGACTAGAGTTGG + Intergenic
923928816 1:238669211-238669233 TGTTCTGGAGATACCAGAGCAGG - Intergenic
924823569 1:247517908-247517930 GGTTCTGGAGAGGCCAAAGCTGG + Intronic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1065282878 10:24157958-24157980 GATTGTGGAGTCACCAGGGCTGG - Intronic
1066519420 10:36198999-36199021 GCTGCTTGAGAGACCAAAGCAGG - Intergenic
1067004964 10:42651904-42651926 GCTTCTGGTGTGGTCGGAGCAGG - Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1076307322 10:129474377-129474399 GCTTCTGGTGAGAGCGGAGCAGG + Intronic
1076889335 10:133276276-133276298 GCTCCTGGAGTGACTTGGGCTGG - Intronic
1078087855 11:8244907-8244929 GCTTCTGGGCTGGTCAGAGCAGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079090338 11:17476353-17476375 GCTTCTGCAGGGCCAAGAGCTGG - Intronic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1081392648 11:42547091-42547113 GCTTCTGCATGGCCCAGAGCTGG - Intergenic
1082910325 11:58365965-58365987 GTCCATGGAGTGACCAGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083876705 11:65527935-65527957 GTGACTGGAGTAACCAGAGCTGG - Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1084748450 11:71188415-71188437 GTTTCTGGAGAGACCTCAGCAGG - Intronic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085206039 11:74732393-74732415 GTTTCTGGTCTGGCCAGAGCTGG - Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1085803807 11:79616103-79616125 GGCTCTGGAGTGAGAAGAGCTGG - Intergenic
1088131496 11:106497450-106497472 ACTCCTGGTGTGACCAGGGCTGG - Intergenic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1090030768 11:123204213-123204235 GCCTCTGAAGTGAGCAGAGATGG + Intergenic
1090518354 11:127452287-127452309 GCTGCTGGGGTGACCAAATCTGG - Intergenic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1091324069 11:134671063-134671085 GCCTTTGCAGTGACCTGAGCGGG + Intergenic
1091835549 12:3583263-3583285 CTTTGTGGGGTGACCAGAGCTGG + Intronic
1091999741 12:5022441-5022463 GCTACTGGAGTGACCACAGAAGG - Intergenic
1092967926 12:13662770-13662792 TCTTCTGGAGTGAGTAGGGCAGG + Intronic
1095421354 12:42027732-42027754 GGCTCTGCAGTGACCGGAGCAGG - Intergenic
1095952147 12:47787455-47787477 GGTGGTGGAGTGAGCAGAGCTGG - Intronic
1096042059 12:48526194-48526216 GCTTCTGGAGATATCAGAGCAGG - Exonic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1103963869 12:124625947-124625969 CCTTCTGGAGGGTCCAGAGGAGG - Intergenic
1103973663 12:124688205-124688227 GCTTCTCGACTGCCCAGTGCTGG + Intergenic
1104746898 12:131216237-131216259 GCTTCAGGGGTGAGCACAGCTGG - Intergenic
1106914720 13:34500135-34500157 ACAGCAGGAGTGACCAGAGCTGG - Intergenic
1107875550 13:44787875-44787897 GCTGCTGTAATGACCATAGCAGG + Intergenic
1111528761 13:89509252-89509274 CCTTCTGCAGAGACCAGAGGTGG - Intergenic
1111611330 13:90611793-90611815 GGTTCTGGAGGAACAAGAGCTGG - Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1112736970 13:102431152-102431174 GCTTCTGGAGTGCCCTGCTCTGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118056490 14:62084406-62084428 GCCTCTGGAAGAACCAGAGCTGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1122986315 14:105213230-105213252 ACTTCTGGAGAGACCACAGTGGG - Intronic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1128335559 15:66783715-66783737 GCTTCTGGGCTGACCACAGCTGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128730126 15:70015269-70015291 GCTTGTGGAGCTAGCAGAGCAGG - Intergenic
1129314815 15:74735266-74735288 GCTTCTGGACTGACCCTAGATGG + Intergenic
1129667400 15:77587289-77587311 GCACCTGTAGTTACCAGAGCAGG - Intergenic
1131051963 15:89354295-89354317 GCTGCTGCAGTGGACAGAGCTGG - Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1132592559 16:732518-732540 GCTTCAGGAGTGACCGGGCCTGG - Intronic
1132627151 16:896711-896733 GATTCTGCAGGGAGCAGAGCTGG - Intronic
1132762644 16:1518290-1518312 GCTCCTGGAGGAACCAGACCTGG - Exonic
1133265327 16:4579958-4579980 GCTTCTGAAGTTACCATGGCCGG - Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134456699 16:14400348-14400370 GCTTCTGAAGTGGGGAGAGCCGG + Intergenic
1137283333 16:46996416-46996438 GTTTCTGGAGAGAGCAGGGCAGG + Intergenic
1138351665 16:56349218-56349240 GCCACTAGAGTGACCTGAGCTGG - Intronic
1138607504 16:58098415-58098437 GCACCTGGAGTGGCCAGAGGAGG - Intergenic
1140621831 16:76743812-76743834 GCTTCTGGACAGAACAAAGCAGG - Intergenic
1141141205 16:81497903-81497925 GCCTCTGGGGGGACCACAGCTGG - Intronic
1142590204 17:1001381-1001403 GCTTCAGGCCTGACCACAGCTGG + Exonic
1143148034 17:4789320-4789342 GCTCCAGGAGGGACCAGAACAGG + Intronic
1143270505 17:5671553-5671575 TCTTCTGCAGCTACCAGAGCAGG - Intergenic
1145269411 17:21396730-21396752 ACCCCTGGAGTCACCAGAGCCGG + Intronic
1145867381 17:28249930-28249952 TCTTCTAGGGTGAGCAGAGCGGG - Intergenic
1150208249 17:63425894-63425916 GCTTCTGGAGTTATAAAAGCTGG - Exonic
1152421952 17:80198355-80198377 GCTTGTGCACTGCCCAGAGCAGG - Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1155774927 18:29749329-29749351 GCTTCTGAAGTGAACTGAGTTGG - Intergenic
1157244589 18:46041942-46041964 GCTTCTCCAGTGTCCAGGGCTGG - Intronic
1157321422 18:46637425-46637447 GATTTTTGAGTGACCAAAGCAGG + Intronic
1159024442 18:63169632-63169654 GCTACTCGGGTGACTAGAGCAGG - Intronic
1160144152 18:76350269-76350291 GCTTCTGGAGAGCAGAGAGCCGG + Intergenic
1160562241 18:79765812-79765834 GCTTCTGAAGAGAGGAGAGCTGG + Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160817622 19:1043386-1043408 GCTTCAGGCGTCTCCAGAGCAGG - Exonic
1161083134 19:2321378-2321400 GGTTCAGGAGTGACCAAGGCGGG - Intronic
1161231810 19:3178420-3178442 GCTTCGGGGGTGATCAGGGCTGG + Intronic
1161293190 19:3506578-3506600 GCTCCTGGAGGGGCCTGAGCTGG - Intronic
1161987481 19:7664413-7664435 GCTACTTGAGAGACCAAAGCAGG - Intergenic
1162030139 19:7913672-7913694 CCTGCTGGGGTGGCCAGAGCAGG + Exonic
1163250632 19:16124574-16124596 CCTTGTGGAGTGCCCACAGCGGG - Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1164471618 19:28541148-28541170 TCTTCTGCAGTGAGCAGAGTGGG + Intergenic
1164846677 19:31438512-31438534 GCTTCTGGGGGAACCTGAGCTGG + Intergenic
1165358592 19:35319400-35319422 GGCTCTGGAGTGGCCAGTGCTGG - Intronic
1165918026 19:39273009-39273031 GCTTCAGGCGTCAGCAGAGCGGG - Intergenic
1166905998 19:46108781-46108803 CTGTCTGGAGTGACCAGCGCTGG + Intergenic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
924961946 2:43640-43662 GGGTCTGGAGGGATCAGAGCAGG + Intronic
930046554 2:47177377-47177399 GGTTCTGGATTGGACAGAGCTGG + Intergenic
931431851 2:62214798-62214820 GCATCTGGAGTGACAGGACCAGG - Intronic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
935819711 2:106882685-106882707 GCTTCTGCAGCGACCAGCACTGG - Intronic
936056185 2:109264007-109264029 GCTTCTGGAGTGTCCTGACCAGG - Intronic
937750388 2:125470142-125470164 GTTTCTACAGTGACAAGAGCAGG + Intergenic
937793905 2:125994521-125994543 GCATCTGGACTGCCCAGGGCTGG - Intergenic
937900636 2:127016503-127016525 GCTTCTGAAGGGGCCACAGCCGG + Intergenic
940865323 2:158812140-158812162 GCTTTTGGGGTGCCCAGAGCAGG - Intronic
941601820 2:167551889-167551911 GGTTCTGGAGTCCTCAGAGCTGG + Intergenic
943069913 2:183128376-183128398 GGTTGTGGAGTCACCGGAGCTGG - Exonic
943618105 2:190116704-190116726 TCTTCTGGTGTGCCCAGAGTTGG + Intronic
945765636 2:213973487-213973509 GGTTCTGGAAGGAGCAGAGCAGG - Intronic
946571262 2:221026595-221026617 GTTTCTAGGGTGACCAGAGAAGG + Intergenic
948454883 2:238100325-238100347 GCTTATCGGGTAACCAGAGCCGG + Exonic
948687410 2:239677724-239677746 GATTCTGGAGAGAGCAGTGCAGG - Intergenic
948784667 2:240346138-240346160 GCTTGTGGAGTGACCCGGCCAGG - Intergenic
1169055284 20:2615997-2616019 TCTTCTCTAGTTACCAGAGCAGG + Intronic
1169067060 20:2700006-2700028 ACTTCTGGGCTGAGCAGAGCAGG - Intronic
1172113631 20:32561497-32561519 GCCTCTGGGGGGCCCAGAGCAGG + Intronic
1172301825 20:33855769-33855791 GCTTCTGGGTTCACCAGAGCTGG - Intergenic
1174452897 20:50630746-50630768 GCTTCAGCAGTGCACAGAGCCGG - Exonic
1175302196 20:57950960-57950982 GCTTCTGGAGGCTCCAGAGGAGG - Intergenic
1175367152 20:58463662-58463684 CCTTCTGGAATGGCCACAGCAGG - Intronic
1175727890 20:61331999-61332021 GGTTCTTCAGTGCCCAGAGCAGG + Intronic
1175762922 20:61573414-61573436 GCTTCTGGAGATGCCAAAGCAGG - Intronic
1176149962 20:63585737-63585759 CCTTCTGGAGTGCCCTGGGCTGG + Intergenic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1176192570 20:63819330-63819352 GCTCCTGGAGGGAGCAAAGCTGG - Intronic
1176236355 20:64055559-64055581 TCTGCTGGTGTGAGCAGAGCAGG + Intronic
1176418772 21:6497879-6497901 GTTTCTGGAGTGACTATAACTGG + Intergenic
1177819878 21:26019441-26019463 ACTTCTGGATTGATCAGAGAAGG - Intronic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179694266 21:43106201-43106223 GTTTCTGGAGTGACTATAACTGG + Intronic
1181576135 22:23796368-23796390 GATTCTGCAGTGACCCGAGACGG + Intronic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1183632645 22:39042689-39042711 ACTCCTGGAACGACCAGAGCTGG + Intronic
1183819189 22:40331122-40331144 GCTTCTGCCGTGTGCAGAGCGGG + Exonic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
1185372479 22:50467445-50467467 TGTTCTGCAATGACCAGAGCGGG + Exonic
950674402 3:14545871-14545893 GTTTCAGCAGTGAACAGAGCAGG + Intergenic
952348401 3:32510332-32510354 GCTTCTGCACTCACCAGTGCAGG + Intergenic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
953290241 3:41653205-41653227 GGCTCTGGAGTGATCAGGGCAGG - Intronic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
959505361 3:107151151-107151173 GGTGCTGGAATGACCAGAGTTGG + Intergenic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
960742150 3:120846216-120846238 AGCTCTGGAGTGAGCAGAGCTGG + Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
967768023 3:193303722-193303744 GCTTCTGCCCTGACCAGAGGAGG - Intronic
968844318 4:3031489-3031511 GCTGCTGGACAAACCAGAGCTGG - Intronic
969087235 4:4665642-4665664 GATTCTGGGGTGGCCAGAGGAGG - Intergenic
969429252 4:7144761-7144783 TCTCCTGGACTGACCAGGGCTGG + Intergenic
969619244 4:8270619-8270641 AGTTCTGAAGAGACCAGAGCTGG - Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970916283 4:21339032-21339054 GCTTCTTGAGCTACCATAGCAGG + Intronic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972739551 4:41877522-41877544 CCAGCTGGAGTGACCAGACCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977043365 4:92041001-92041023 GTTCCGGGTGTGACCAGAGCAGG + Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
981164817 4:141545277-141545299 GGTTATGGTGTGATCAGAGCTGG - Intergenic
984757223 4:183336311-183336333 GGTTCTGGAGTAAAGAGAGCCGG + Intergenic
986505118 5:8441684-8441706 GCTTCTGAAGTGAGAAGAGTGGG + Intergenic
986705806 5:10453865-10453887 GGTTCTGGAGTGAACAAAACGGG + Intronic
988143639 5:27275521-27275543 GTTTCTGCAGAGAACAGAGCAGG + Intergenic
989327278 5:40213341-40213363 GCATCTGGAGAGAGAAGAGCTGG + Intergenic
992366086 5:76091404-76091426 GTTGCTGCAGGGACCAGAGCAGG - Intronic
994494036 5:100487974-100487996 GATTCTGGAGAGGCCAGAGGTGG - Intergenic
995894612 5:116997905-116997927 GCTTCTGGAATCACAATAGCAGG + Intergenic
996110125 5:119555674-119555696 GTGTGTGGAGTGAGCAGAGCAGG + Intronic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
1002096059 5:176831624-176831646 CCTCCTGCAGTGCCCAGAGCGGG + Intronic
1003317673 6:5026694-5026716 GCCTATGGAGTCACCAGGGCAGG - Intergenic
1004478897 6:16000261-16000283 TACTCTGGAGTGACCAGAGAAGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1004597091 6:17110270-17110292 GCTACTGGAGAGACCAAGGCAGG + Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006339878 6:33440975-33440997 GCTTCAGGAGTGGGCAGGGCAGG + Intronic
1007045834 6:38773469-38773491 GCTTCTCCAGAGACCAGAGTGGG - Intronic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1010772506 6:79847704-79847726 ACTTCTGCTGTGATCAGAGCTGG + Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012630104 6:101455355-101455377 GCTTCTTAAGTGACTAGAGTGGG + Intronic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1015583832 6:134755568-134755590 GCTTCTGGAGAGGCCTCAGCAGG - Intergenic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1017484173 6:154887898-154887920 CGTTCTGGAGTCCCCAGAGCTGG + Intronic
1018341607 6:162856880-162856902 GCATCTGGAGTGACTCCAGCGGG + Intronic
1018737419 6:166697859-166697881 GCTACAGAAGTGAGCAGAGCAGG - Intronic
1019287331 7:230259-230281 GCTCCTGGAGCCCCCAGAGCTGG + Intronic
1019394803 7:812099-812121 GGTTCTGGAGAGAACAGAGGAGG - Intergenic
1024140657 7:46460106-46460128 GGTCCTGGAGTGAACAGGGCAGG - Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1035412573 7:158656910-158656932 GCTTCTTCAGTGTCCAGAGCTGG - Intronic
1038863673 8:31415134-31415156 GCTTCTGCATTGAACAGTGCAGG - Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041011631 8:53549495-53549517 TGGTCTGGGGTGACCAGAGCAGG - Intergenic
1041527368 8:58822483-58822505 ACAGCAGGAGTGACCAGAGCCGG + Intronic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1047220071 8:122911792-122911814 TCATCTGGAATGATCAGAGCAGG + Intronic
1047401675 8:124553503-124553525 ACCCCTGGAGTGACCATAGCAGG + Exonic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1052037770 9:23702483-23702505 GCTAGTGGGGTGACCACAGCTGG + Intronic
1054717608 9:68572068-68572090 GCTTGTGTAGTGATCAGAACGGG - Intergenic
1054735821 9:68748971-68748993 GCTTCTGAGGTGGACAGAGCTGG + Intronic
1056588300 9:87943950-87943972 GCTTCGGGAGGGCCCAGATCAGG + Intergenic
1059326473 9:113506931-113506953 GCTTCTGGAATAACCAGATGAGG + Intronic
1060976978 9:127770642-127770664 GCATCTGGAGTGTCCCGAGGAGG - Intronic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062194061 9:135263650-135263672 GCTTCTGGGAGGACCAGAGTAGG - Intergenic
1186210868 X:7249336-7249358 GCTTCAGGAGCAACCAGTGCAGG + Intronic
1190343240 X:49313849-49313871 GCCTCTGGTGTGGTCAGAGCAGG - Intronic
1191897760 X:66011725-66011747 GCTACTGTATTGACCAGAACAGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1195042808 X:101029800-101029822 ACATCTGGAGTGACCACAGAGGG + Intronic
1195218198 X:102721220-102721242 GCTTCAGGGGAGCCCAGAGCGGG + Intronic
1196145004 X:112306830-112306852 GTTTCTGCAGTGGCCACAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199754637 X:150852674-150852696 TCATCTGAGGTGACCAGAGCAGG - Intronic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202095245 Y:21243014-21243036 GCTTGTGGTGTGACTAGGGCAGG + Intergenic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic