ID: 901996066

View in Genome Browser
Species Human (GRCh38)
Location 1:13152739-13152761
Sequence GACCCAGCTGTTCCTTCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901996058_901996066 11 Left 901996058 1:13152705-13152727 CCACCATCGCCCCTTGGGCCTCC No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996063_901996066 -7 Left 901996063 1:13152723-13152745 CCTCCTCACTTCTCATGACCCAG No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996060_901996066 2 Left 901996060 1:13152714-13152736 CCCCTTGGGCCTCCTCACTTCTC No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996064_901996066 -10 Left 901996064 1:13152726-13152748 CCTCACTTCTCATGACCCAGCTG No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996054_901996066 19 Left 901996054 1:13152697-13152719 CCTCACCACCACCATCGCCCCTT No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996059_901996066 8 Left 901996059 1:13152708-13152730 CCATCGCCCCTTGGGCCTCCTCA No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996057_901996066 14 Left 901996057 1:13152702-13152724 CCACCACCATCGCCCCTTGGGCC No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996061_901996066 1 Left 901996061 1:13152715-13152737 CCCTTGGGCCTCCTCACTTCTCA No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996062_901996066 0 Left 901996062 1:13152716-13152738 CCTTGGGCCTCCTCACTTCTCAT No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data
901996053_901996066 30 Left 901996053 1:13152686-13152708 CCTCTCAGCTTCCTCACCACCAC No data
Right 901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901996066 Original CRISPR GACCCAGCTGTTCCTTCGGT TGG Intergenic
No off target data available for this crispr