ID: 901996107

View in Genome Browser
Species Human (GRCh38)
Location 1:13152889-13152911
Sequence CCTCAGAGGGAGGCGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901996097_901996107 27 Left 901996097 1:13152839-13152861 CCATTGAGCACAGCTTGGAAGGT No data
Right 901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG No data
901996099_901996107 2 Left 901996099 1:13152864-13152886 CCAGACAAGGCATCTTTATCAGA No data
Right 901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG No data
901996095_901996107 28 Left 901996095 1:13152838-13152860 CCCATTGAGCACAGCTTGGAAGG No data
Right 901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901996107 Original CRISPR CCTCAGAGGGAGGCGGCGGA AGG Intergenic
No off target data available for this crispr