ID: 901998780

View in Genome Browser
Species Human (GRCh38)
Location 1:13175465-13175487
Sequence CCTCAGAGGGAGGCGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901998780_901998788 2 Left 901998780 1:13175465-13175487 CCTTCCGCCGCCTCCCTCTGAGG No data
Right 901998788 1:13175490-13175512 TCTGATAAAGATGCCTTGTCTGG No data
901998780_901998791 27 Left 901998780 1:13175465-13175487 CCTTCCGCCGCCTCCCTCTGAGG No data
Right 901998791 1:13175515-13175537 GCCTTCCAAGCTGTGCTCGATGG No data
901998780_901998789 5 Left 901998780 1:13175465-13175487 CCTTCCGCCGCCTCCCTCTGAGG No data
Right 901998789 1:13175493-13175515 GATAAAGATGCCTTGTCTGGAGG No data
901998780_901998793 28 Left 901998780 1:13175465-13175487 CCTTCCGCCGCCTCCCTCTGAGG No data
Right 901998793 1:13175516-13175538 CCTTCCAAGCTGTGCTCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901998780 Original CRISPR CCTCAGAGGGAGGCGGCGGA AGG (reversed) Intergenic
No off target data available for this crispr