ID: 902003272

View in Genome Browser
Species Human (GRCh38)
Location 1:13211094-13211116
Sequence GCTGCTACCAAAACAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902003267_902003272 21 Left 902003267 1:13211050-13211072 CCATTAACTTGGAAAACAGAAAA 0: 30
1: 11
2: 6
3: 72
4: 813
Right 902003272 1:13211094-13211116 GCTGCTACCAAAACAAAAGCTGG No data
902003271_902003272 -3 Left 902003271 1:13211074-13211096 CCTGTATGGGTAAATCAGTGGCT 0: 5
1: 12
2: 23
3: 17
4: 107
Right 902003272 1:13211094-13211116 GCTGCTACCAAAACAAAAGCTGG No data
902003266_902003272 26 Left 902003266 1:13211045-13211067 CCATTCCATTAACTTGGAAAACA No data
Right 902003272 1:13211094-13211116 GCTGCTACCAAAACAAAAGCTGG No data
902003265_902003272 27 Left 902003265 1:13211044-13211066 CCCATTCCATTAACTTGGAAAAC No data
Right 902003272 1:13211094-13211116 GCTGCTACCAAAACAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902003272 Original CRISPR GCTGCTACCAAAACAAAAGC TGG Intergenic
No off target data available for this crispr