ID: 902004858

View in Genome Browser
Species Human (GRCh38)
Location 1:13224163-13224185
Sequence CCAGAGATGAAGCTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004858_902004868 27 Left 902004858 1:13224163-13224185 CCAGCAGAAAGCTTCATCTCTGG No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004858_902004862 -5 Left 902004858 1:13224163-13224185 CCAGCAGAAAGCTTCATCTCTGG No data
Right 902004862 1:13224181-13224203 TCTGGGCCACAGGAGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004858 Original CRISPR CCAGAGATGAAGCTTTCTGC TGG (reversed) Intergenic