ID: 902004863

View in Genome Browser
Species Human (GRCh38)
Location 1:13224187-13224209
Sequence TCTCTTCCACTGGGCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004863_902004868 3 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004863_902004869 9 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004869 1:13224219-13224241 AACTGACCTGAGCAAGGTCTAGG No data
902004863_902004872 22 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004863_902004873 23 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004863_902004870 10 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004870 1:13224220-13224242 ACTGACCTGAGCAAGGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004863 Original CRISPR TCTCTTCCACTGGGCTCCTG TGG (reversed) Intergenic