ID: 902004865

View in Genome Browser
Species Human (GRCh38)
Location 1:13224197-13224219
Sequence TCTTTGGGCATCTCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004865_902004868 -7 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004865_902004870 0 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004870 1:13224220-13224242 ACTGACCTGAGCAAGGTCTAGGG No data
902004865_902004873 13 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004865_902004872 12 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004865_902004869 -1 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004869 1:13224219-13224241 AACTGACCTGAGCAAGGTCTAGG No data
902004865_902004874 30 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004865 Original CRISPR TCTTTGGGCATCTCTTCCAC TGG (reversed) Intergenic