ID: 902004866

View in Genome Browser
Species Human (GRCh38)
Location 1:13224212-13224234
Sequence CTTGCTCAGGTCAGTTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004866_902004874 15 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data
902004866_902004876 28 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004876 1:13224263-13224285 CTTTCAGAGGCTCCCTGACATGG No data
902004866_902004872 -3 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004866_902004873 -2 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004866 Original CRISPR CTTGCTCAGGTCAGTTCTTT GGG (reversed) Intergenic