ID: 902004867

View in Genome Browser
Species Human (GRCh38)
Location 1:13224213-13224235
Sequence CCTTGCTCAGGTCAGTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004867_902004873 -3 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004867_902004874 14 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data
902004867_902004876 27 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004876 1:13224263-13224285 CTTTCAGAGGCTCCCTGACATGG No data
902004867_902004872 -4 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004867 Original CRISPR CCTTGCTCAGGTCAGTTCTT TGG (reversed) Intergenic