ID: 902004868

View in Genome Browser
Species Human (GRCh38)
Location 1:13224213-13224235
Sequence CCAAAGAACTGACCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004858_902004868 27 Left 902004858 1:13224163-13224185 CCAGCAGAAAGCTTCATCTCTGG No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004863_902004868 3 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004864_902004868 -6 Left 902004864 1:13224196-13224218 CCCAGTGGAAGAGATGCCCAAAG No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
902004865_902004868 -7 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004868 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004868 Original CRISPR CCAAAGAACTGACCTGAGCA AGG Intergenic