ID: 902004870

View in Genome Browser
Species Human (GRCh38)
Location 1:13224220-13224242
Sequence ACTGACCTGAGCAAGGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004865_902004870 0 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004870 1:13224220-13224242 ACTGACCTGAGCAAGGTCTAGGG No data
902004864_902004870 1 Left 902004864 1:13224196-13224218 CCCAGTGGAAGAGATGCCCAAAG No data
Right 902004870 1:13224220-13224242 ACTGACCTGAGCAAGGTCTAGGG No data
902004863_902004870 10 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004870 1:13224220-13224242 ACTGACCTGAGCAAGGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004870 Original CRISPR ACTGACCTGAGCAAGGTCTA GGG Intergenic