ID: 902004872

View in Genome Browser
Species Human (GRCh38)
Location 1:13224232-13224254
Sequence AAGGTCTAGGGACATCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004866_902004872 -3 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004867_902004872 -4 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004864_902004872 13 Left 902004864 1:13224196-13224218 CCCAGTGGAAGAGATGCCCAAAG No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004863_902004872 22 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data
902004865_902004872 12 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004872 1:13224232-13224254 AAGGTCTAGGGACATCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004872 Original CRISPR AAGGTCTAGGGACATCAGCT AGG Intergenic