ID: 902004873

View in Genome Browser
Species Human (GRCh38)
Location 1:13224233-13224255
Sequence AGGTCTAGGGACATCAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004867_902004873 -3 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004865_902004873 13 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004864_902004873 14 Left 902004864 1:13224196-13224218 CCCAGTGGAAGAGATGCCCAAAG No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004866_902004873 -2 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data
902004863_902004873 23 Left 902004863 1:13224187-13224209 CCACAGGAGCCCAGTGGAAGAGA No data
Right 902004873 1:13224233-13224255 AGGTCTAGGGACATCAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004873 Original CRISPR AGGTCTAGGGACATCAGCTA GGG Intergenic