ID: 902004874

View in Genome Browser
Species Human (GRCh38)
Location 1:13224250-13224272
Sequence CTAGGGCTACCTGCTTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004867_902004874 14 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data
902004866_902004874 15 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data
902004871_902004874 2 Left 902004871 1:13224225-13224247 CCTGAGCAAGGTCTAGGGACATC No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data
902004865_902004874 30 Left 902004865 1:13224197-13224219 CCAGTGGAAGAGATGCCCAAAGA No data
Right 902004874 1:13224250-13224272 CTAGGGCTACCTGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004874 Original CRISPR CTAGGGCTACCTGCTTTCAG AGG Intergenic