ID: 902004876

View in Genome Browser
Species Human (GRCh38)
Location 1:13224263-13224285
Sequence CTTTCAGAGGCTCCCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902004866_902004876 28 Left 902004866 1:13224212-13224234 CCCAAAGAACTGACCTGAGCAAG No data
Right 902004876 1:13224263-13224285 CTTTCAGAGGCTCCCTGACATGG No data
902004867_902004876 27 Left 902004867 1:13224213-13224235 CCAAAGAACTGACCTGAGCAAGG No data
Right 902004876 1:13224263-13224285 CTTTCAGAGGCTCCCTGACATGG No data
902004871_902004876 15 Left 902004871 1:13224225-13224247 CCTGAGCAAGGTCTAGGGACATC No data
Right 902004876 1:13224263-13224285 CTTTCAGAGGCTCCCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902004876 Original CRISPR CTTTCAGAGGCTCCCTGACA TGG Intergenic