ID: 902005553

View in Genome Browser
Species Human (GRCh38)
Location 1:13229188-13229210
Sequence TCTTCCACTCAGGACTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902005544_902005553 27 Left 902005544 1:13229138-13229160 CCGGTTTTGCTTTTCTGTCTAAT No data
Right 902005553 1:13229188-13229210 TCTTCCACTCAGGACTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902005553 Original CRISPR TCTTCCACTCAGGACTAGGA AGG Intergenic
No off target data available for this crispr