ID: 902015044

View in Genome Browser
Species Human (GRCh38)
Location 1:13299985-13300007
Sequence CTCCTTCACCAACTGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902015044_902015048 -5 Left 902015044 1:13299985-13300007 CCTATTTCCAGTTGGTGAAGGAG No data
Right 902015048 1:13300003-13300025 AGGAGGGTTTCGATGATCACTGG No data
902015044_902015049 17 Left 902015044 1:13299985-13300007 CCTATTTCCAGTTGGTGAAGGAG No data
Right 902015049 1:13300025-13300047 GACCTTCATGCCCTACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902015044 Original CRISPR CTCCTTCACCAACTGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr