ID: 902017266

View in Genome Browser
Species Human (GRCh38)
Location 1:13318592-13318614
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 9, 1: 0, 2: 0, 3: 31, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902017266_902017279 28 Left 902017266 1:13318592-13318614 CCTTCCGCCGCCTCCCTCTGAGG 0: 9
1: 0
2: 0
3: 31
4: 363
Right 902017279 1:13318643-13318665 CCTTCCAAGCTGTGCTCGATGGG 0: 8
1: 2
2: 0
3: 6
4: 63
902017266_902017274 2 Left 902017266 1:13318592-13318614 CCTTCCGCCGCCTCCCTCTGAGG 0: 9
1: 0
2: 0
3: 31
4: 363
Right 902017274 1:13318617-13318639 TCTGATAAAGATGCCTTGTCTGG 0: 9
1: 0
2: 1
3: 10
4: 112
902017266_902017275 5 Left 902017266 1:13318592-13318614 CCTTCCGCCGCCTCCCTCTGAGG 0: 9
1: 0
2: 0
3: 31
4: 363
Right 902017275 1:13318620-13318642 GATAAAGATGCCTTGTCTGGAGG 0: 7
1: 0
2: 1
3: 9
4: 132
902017266_902017277 27 Left 902017266 1:13318592-13318614 CCTTCCGCCGCCTCCCTCTGAGG 0: 9
1: 0
2: 0
3: 31
4: 363
Right 902017277 1:13318642-13318664 GCCTTCCAAGCTGTGCTCGATGG 0: 7
1: 1
2: 2
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902017266 Original CRISPR CCTCAGAGGGAGGCGGCGGA AGG (reversed) Exonic
900117354 1:1034296-1034318 GCTCCGAGGTAGGCGGAGGAGGG - Intronic
900611754 1:3547196-3547218 CCTCAGAGGGATGAGGCTCAGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901989067 1:13097771-13097793 TCCCAGAGGGAGGCGGGTGAAGG + Intergenic
901992746 1:13128996-13129018 TCCCAGAGGGAGGCGGGTGAAGG - Intergenic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902007782 1:13246041-13246063 TCCCAGAGGGAGGTGGAGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902304732 1:15527101-15527123 TCTCGGAGGGCGGCGGGGGAGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903833901 1:26190456-26190478 CCTCTGTGGGATGCGGAGGAGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904467994 1:30719251-30719273 CCTCAGACTGAGGCGGCTGAGGG + Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905252025 1:36655677-36655699 AATCAAAGGGAGGCAGCGGAGGG - Intergenic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908650913 1:66332227-66332249 CCTCTGAGGAAGAAGGCGGAGGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910251148 1:85200782-85200804 CCTCAGAGGGAGCCGCGGGGAGG - Exonic
912741167 1:112198916-112198938 ACTCAGAGGGTGGGGGCTGAGGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915322427 1:155063109-155063131 CCTCAGGTGGCGGCGGCGGAGGG - Intergenic
915358445 1:155270930-155270952 CCTCAGAGCGAGGCAGCCGGGGG - Exonic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
920038465 1:203080806-203080828 CTGGAGAGGGAGGCGGCAGAGGG - Intergenic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
1062930325 10:1348534-1348556 CCTCAGATGGAGGCAGCCGAGGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065954097 10:30677653-30677675 CCTAAGAGGGAGGGGACAGAGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070328362 10:75402014-75402036 AAAAAGAGGGAGGCGGCGGATGG - Intergenic
1070811774 10:79301700-79301722 TGTCAGAGTGAGGCGGCTGATGG + Intronic
1071496399 10:86170260-86170282 CCTCAGAGCCAGCAGGCGGATGG + Intronic
1071530633 10:86388418-86388440 CCTCTGAGGGAGGCGGGAGGCGG - Intergenic
1072410056 10:95193675-95193697 CCTCAGCGGGGGGCGGTGGGAGG - Intergenic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1073176369 10:101559964-101559986 GCTCAGAGGAAGGGGGAGGAAGG - Intergenic
1073288242 10:102401023-102401045 CTTCAGAAGGAGGCGGGTGAGGG - Exonic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076167448 10:128293906-128293928 CCTCACAGGGAGGCGGAAGTGGG - Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1077048192 11:555355-555377 CCTCTGCGGGAGGCGACGGCAGG + Exonic
1077056382 11:595884-595906 CAGCAGAGGGGGGCGGCGGGTGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078245848 11:9573216-9573238 CCTCCGAGGGCAGCGGCCGAAGG + Intergenic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1081873164 11:46392230-46392252 CCCCAGCGGGAGGCTGCGGGTGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083274250 11:61587892-61587914 GCCCAGAGGGAGGAGGGGGACGG + Intergenic
1083678269 11:64340040-64340062 GCCCAGAGGTTGGCGGCGGAAGG - Intergenic
1084868543 11:72080275-72080297 CCTGAGAGGGAGGAGCCGGGGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1089617992 11:119705944-119705966 CCTGAGAGGGAGGCGGGGAGGGG + Intronic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090265348 11:125350008-125350030 CCTCAGGGAGAGGGGACGGAGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091242796 11:134065335-134065357 CCTTAGAGGGAGGTGGGAGAAGG + Intergenic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093197017 12:16141644-16141666 CCTAAAAGGGAGGAGGCTGAAGG + Intergenic
1093464912 12:19439645-19439667 CGAGAGAGGGAGGCGGCGGTGGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096782136 12:53997608-53997630 GCAGAGAGGGAGGCGGAGGAAGG - Intronic
1096800449 12:54106981-54107003 GCTGAGTGGGAGGCGGCTGACGG - Intergenic
1096983728 12:55743374-55743396 CCCCGGGGGGAGGCGGCCGAGGG + Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1102990755 12:117314063-117314085 GCTCAGAGGGAGCCGCTGGAGGG - Intronic
1104415475 12:128594037-128594059 CCTCAGTGGGTGGTGGGGGAGGG - Intronic
1109062124 13:57632695-57632717 CTGCAGAGCGCGGCGGCGGAGGG + Exonic
1112415532 13:99200867-99200889 CCCCAGAGGGCGCCGGGGGAGGG - Exonic
1113616571 13:111684803-111684825 CCTCAGAATGAGGCCACGGAAGG + Intergenic
1113622101 13:111770074-111770096 CCTCAGAATGAGGCCACGGAAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113759166 13:112835624-112835646 ACTCAGTGGGAAGCTGCGGAGGG - Intronic
1114195050 14:20469609-20469631 GCCCAGAGGGAGCTGGCGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116018419 14:39432869-39432891 GCTGAGAGGGAGCTGGCGGACGG + Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123106705 14:105845172-105845194 CCTCAGAGAGAGGGAGCGGAGGG + Intergenic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127579035 15:60320325-60320347 CCACAGAGGGTGGAGCCGGAAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128877598 15:71215038-71215060 CCGCAGCGGATGGCGGCGGAGGG + Exonic
1129135301 15:73544052-73544074 ACTCAGAAGGATGGGGCGGAAGG - Intronic
1129198909 15:73986982-73987004 CCTCAGAGAGGGGAGGCAGAAGG + Intronic
1129267466 15:74401659-74401681 CCCCAGAGGGAGGCGCCTGCAGG - Intergenic
1131483628 15:92802586-92802608 CCTAAGAGGGAGGCAGAGGAAGG - Intronic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133464955 16:6019879-6019901 CATAAGCTGGAGGCGGCGGAAGG - Intronic
1136080986 16:27852527-27852549 GGTCAGAGGGAGGAGGAGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138347953 16:56331505-56331527 CCTGAGTGGGAGGAGGCTGATGG - Intronic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1139517034 16:67458256-67458278 TCTCTGAGGGATGCGGAGGAGGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139805883 16:69565590-69565612 CCCCAGAGGCCGGCGGCGGACGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140686134 16:77435184-77435206 GCTCTGAGGGAGGGGGCGAAGGG + Intergenic
1140975008 16:80051260-80051282 CCTCAGAGGTAGGCGTGGCACGG + Intergenic
1141683070 16:85555334-85555356 ACTCAGAGAGAGGGGGTGGAAGG - Intergenic
1142304937 16:89279733-89279755 GCACAGAGGGACGCGGCGGGGGG + Exonic
1142656833 17:1399986-1400008 CCTCTGTGGGCGGCGGCAGAGGG + Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143474870 17:7196774-7196796 CCTCAGTGGGGAGCTGCGGAAGG - Exonic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144638472 17:16925287-16925309 CCCCAGAGGGAGACTCCGGAGGG + Intergenic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147138962 17:38451080-38451102 CCCCAGAGGGTGGTGGCGGAGGG - Intronic
1147469757 17:40648178-40648200 CCGCGGTGGGAGACGGCGGATGG + Exonic
1147571136 17:41571861-41571883 CCTCAGGGGGCGGTGGAGGAGGG - Exonic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1147794585 17:43033438-43033460 CCTAGGAGGGAGGAGGGGGAAGG + Intergenic
1147843448 17:43388740-43388762 GGGCAGAGGGAGGCGGCGCATGG + Intergenic
1148850095 17:50550442-50550464 TCTCTGAGGCAGGCGGGGGAGGG - Intronic
1149657974 17:58320189-58320211 CCAGAGAGGGAGGCGGAGAAGGG + Intronic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150595869 17:66604037-66604059 CTTCAGTGGGAAGCGGGGGAAGG - Intronic
1150795642 17:68234659-68234681 ACTCAGAGGGCTGAGGCGGAAGG + Intergenic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152396440 17:80036130-80036152 CTGCAGAGGGCGGCAGCGGAGGG - Intergenic
1152521031 17:80857166-80857188 CCTCAGAGGCAGGGGAGGGAGGG - Intronic
1153476273 18:5502052-5502074 CCTCAGAGGCAGGAGGCAGGAGG - Intronic
1154284240 18:13036648-13036670 CCTCAGAGGGATGGGGCAAATGG - Intronic
1155152651 18:23135329-23135351 CCGCAGAGGCAGACGGCGGGAGG - Intronic
1156253875 18:35377093-35377115 ACTCAGGGGCAGGCAGCGGAGGG + Intronic
1157272951 18:46290568-46290590 CCTCAGAGGCAGCCAGCGGGGGG + Intergenic
1160537650 18:79603674-79603696 CCTCTCAGGGCGGGGGCGGAGGG - Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1161276964 19:3423793-3423815 CCCCAGAGAGAGGAGGCTGAGGG - Intronic
1161378242 19:3950891-3950913 CCTCAGTGGGGGGAGGCGAATGG - Intergenic
1161437621 19:4273162-4273184 CATCAGAGGGATGGGGAGGAGGG + Intergenic
1161583173 19:5091721-5091743 GCCCAGGGGGAGGCGGCAGAAGG + Intronic
1161900722 19:7117180-7117202 TGTCAGAGGGAGGAGGCGGGGGG - Exonic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1163190217 19:15672229-15672251 CCTTAGAGGGCGACGGAGGAAGG - Intergenic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1163555488 19:17989997-17990019 CTTCAGAGGGAGGCAGATGATGG + Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164835333 19:31351877-31351899 CCGCAGTGGGAGGGGGCCGAAGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166765657 19:45251284-45251306 CGGCGGAGGGAGGCGGTGGAGGG - Exonic
1167668319 19:50835855-50835877 CAACAGAGGGAGGCGGCTGCAGG - Intronic
1167688577 19:50971327-50971349 CCCCAGAGAGAGGAGGCAGAGGG - Intergenic
1167695976 19:51015832-51015854 CCTCAGGAGGAGGGGGCTGAGGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926153224 2:10435928-10435950 ACTCAGAAGGAGGCGGCCGTGGG + Intergenic
926273887 2:11388878-11388900 GCTCAGAGGGAGGAGGCTCAGGG - Intergenic
926994919 2:18724421-18724443 CCACAGAGGGATGTGGGGGATGG + Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927553673 2:24018360-24018382 CCGCACAGGGAGGTGGCAGAAGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928916596 2:36478540-36478562 CCAGAGAGGGAGGCGGCCAATGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930575270 2:53139394-53139416 AGGCTGAGGGAGGCGGCGGATGG - Intergenic
932449507 2:71800580-71800602 ACTCAGAGGGAGGCAGCTGATGG - Intergenic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
933858862 2:86444123-86444145 CCTCAAAGGATGGGGGCGGAGGG - Intronic
935591738 2:104851594-104851616 TCGCAAAGGGAGGGGGCGGATGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936096412 2:109533514-109533536 CCTGAGGAGGAGGCTGCGGATGG + Intergenic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
938092853 2:128444599-128444621 GCTCAGAGGGAGGTGGTGCAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939961884 2:148572503-148572525 CCTCAGAGGGGTGGGGAGGAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
942450095 2:176103929-176103951 ACTCAGAGGGCGGCGGGGAAGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945826365 2:214724855-214724877 CCTCAAGTGGAGGTGGCGGAAGG + Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946865611 2:224039113-224039135 CCCCAGGGGGCGGCCGCGGAGGG + Intronic
948206390 2:236164690-236164712 CCTCAGTCGGAGGCGGAGGCTGG - Intergenic
948272221 2:236683382-236683404 GCTCAGAGGGAGGAGTCAGAAGG + Intergenic
948405880 2:237718493-237718515 CCACATAGGGAGGCTGCGGAAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1171370067 20:24656736-24656758 CCTGAGAGGGAGGGGGCTGCGGG - Intronic
1171852225 20:30316787-30316809 GCTGAGGGGGAGGCGGCTGACGG - Intergenic
1172275772 20:33678320-33678342 CCACAGTGGGCGTCGGCGGACGG - Exonic
1173226308 20:41164195-41164217 CCTCAGAGTGAGTCGGAGGCTGG + Exonic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1174562677 20:51442791-51442813 CCTGAGAGGGAGGCTGGGCATGG + Intronic
1175472661 20:59242771-59242793 CCTCAGAGAGATGTGGCTGAAGG - Intronic
1175744447 20:61445445-61445467 CCTCTGAGGCAGGCGGGGCATGG + Intronic
1176085937 20:63295527-63295549 CACCAGTGGGAGGCGGCGGTGGG - Intronic
1176130921 20:63496543-63496565 CCTCAGAGGGATGGGGAGGCTGG - Intronic
1176194973 20:63832521-63832543 CGGCAGTGGGAGGCGGCTGAGGG + Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1179481424 21:41681270-41681292 GCTCAGGGCGAGGAGGCGGAAGG - Intergenic
1179614562 21:42573391-42573413 CCTCAGAGGGAGACAGCACAGGG - Intronic
1179626829 21:42653740-42653762 CCGCCGCGGGAGGCGGGGGAGGG - Exonic
1179953728 21:44726448-44726470 TCCCAGAGGAAGGAGGCGGAGGG + Intergenic
1180155410 21:45975014-45975036 CCTGGGAGGGAGTCGCCGGACGG + Intergenic
1180635063 22:17257467-17257489 CCTCTGGGGGAGGCGGGAGAGGG + Intergenic
1180837099 22:18935348-18935370 CCTCAACAGGAGGCGGGGGAAGG - Intronic
1181064858 22:20300675-20300697 CCTCAACAGGAGGCGGGGGAAGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1182222900 22:28772869-28772891 GCTCAGAGGGAGGCCGCTGAAGG - Exonic
1182320262 22:29474238-29474260 CCACAGAGTGAGGTGGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184537793 22:45099511-45099533 CCTCAGGGGCAGGTGGCAGAGGG - Intergenic
1184673427 22:46027641-46027663 CCTCAGACGGTGGCGGCGCTCGG - Intergenic
1185179810 22:49352836-49352858 CCTCAGAGGGCGGCCCCGGCTGG - Intergenic
1203287192 22_KI270734v1_random:160647-160669 CCTCAACAGGAGGCGGGGGAAGG - Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950282696 3:11720586-11720608 CCTCCGGGCGAGGCGGGGGAAGG - Intronic
950306246 3:11917128-11917150 GCTGAGGGGGAGCCGGCGGAGGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
954105826 3:48409464-48409486 CCTCAGAGGCAAGCTGCGGGTGG + Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959817947 3:110698087-110698109 GCTAAGAGGGAGGCGGGGGGAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960913864 3:122678336-122678358 CCTCAGAGGGAGCCCCCTGATGG - Intergenic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
962108469 3:132417560-132417582 AGGCAGAGGGAGGAGGCGGAGGG + Exonic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968131237 3:196194044-196194066 GCTGAGTGGGAGGCAGCGGAGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968649088 4:1753367-1753389 CCTCAGAGGGAAGCGTGGCAGGG + Intergenic
969378443 4:6778573-6778595 CCTCAGAGGGTTGCGGTGAAGGG - Intergenic
969457359 4:7307633-7307655 CATCAGAGGGAAGCGGCTGAGGG + Intronic
969502994 4:7565073-7565095 GCTCAGAGGGAGGGGGAGCAAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972326546 4:38021931-38021953 CCTTGGAGGGAGGTGGCAGAAGG - Intronic
972396923 4:38664997-38665019 CCTGGGAGGGGGGCGGCGGGGGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974017465 4:56661426-56661448 CCTCATAGAGAGGCTGCAGAAGG - Intronic
974329283 4:60455783-60455805 CCTCAGAGGGAGGCAGGCCAGGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978912647 4:114082661-114082683 GCACTGAGGGAGGTGGCGGAGGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983045349 4:162980256-162980278 CCTCAGAGGTAGGCAGGGGTAGG + Intergenic
983941621 4:173538843-173538865 GCGCGGGGGGAGGCGGCGGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984959485 4:185081617-185081639 ACTCAGAGGGTGGGGGCTGAGGG - Intergenic
985557629 5:565273-565295 CCGCAGAGGGGCGCGGCTGACGG + Intergenic
985557701 5:565533-565555 CCGCAGAGGGGCGCGGCTGACGG + Intergenic
985557763 5:565748-565770 CCGCAGAGGGGCGCGGCTGAGGG + Intergenic
985775780 5:1841076-1841098 CCTCAGTGGGAGTCGGCCCAGGG - Intergenic
985875801 5:2592958-2592980 CCTCACAGGAATACGGCGGAGGG - Intergenic
988629058 5:32909766-32909788 CCTCCAAGAGAGGGGGCGGAGGG - Intergenic
989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990738409 5:58888531-58888553 CCACAGAGGGAGGTGGGGAAGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991435695 5:66596049-66596071 CGTCAGAGGGAGACGGCGAGCGG - Intergenic
995310011 5:110699778-110699800 CCTCAGAGGGTGGTGGAGGAGGG - Intronic
996862574 5:128083370-128083392 CCGCAGAGCGCGGCGGGGGAGGG + Intergenic
998130243 5:139648209-139648231 GCTGGGAGGGAGGCGGCGGGAGG + Intronic
998179208 5:139924777-139924799 CCGGAAAGGGAGGCGGCTGAGGG - Intronic
998353174 5:141514120-141514142 ACTCAGAGCCAGGCTGCGGAGGG + Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1001568239 5:172714143-172714165 CCTCCGGGGGAGGCAGGGGAGGG - Intergenic
1002107047 5:176884776-176884798 CCTCTGAGGGAGGGGGCAGGGGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002785070 6:393717-393739 CCACGGACGGAGGCGGCAGACGG - Intronic
1002928685 6:1619463-1619485 CCTGAGAGGGGGGAGGGGGATGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003382332 6:5636617-5636639 CTTCAGAGGGAGGCAGAGAAGGG + Intronic
1006055000 6:31377691-31377713 CCTCAGCGGGAGGCTGCAGCAGG - Intergenic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1007422344 6:41727366-41727388 GCTCAGAGGGTGGCGGAGGGTGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1015840652 6:137473412-137473434 CCTCAGAGGGAGGGGAGGGGCGG + Intergenic
1017493299 6:154962840-154962862 CCACAGTGGGAGGCGGGGGCTGG - Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018628889 6:165805356-165805378 CCCCGGAGGGAGGCGGAAGAAGG + Intronic
1019455325 7:1123815-1123837 CTTCCGAGGGAGCTGGCGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019681244 7:2351008-2351030 ACTCAGGAGGAGGCGGCGGGAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021729933 7:23586308-23586330 CCTCAGAGCGAGGCAGCCGGGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022164130 7:27740805-27740827 CCTCAAAAGTAGGCGGCGCAGGG - Intronic
1024413571 7:49077256-49077278 CTTCAGAGAGAGGCAGCTGAAGG + Intergenic
1025097294 7:56106281-56106303 ACGCAGAGGGAGGCCGCGGGCGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027774186 7:82443953-82443975 AGTCAGAGGGAGGCGGCTGGGGG + Intergenic
1030176501 7:106660422-106660444 CCTCGGGGGGCGGCGGCGGTGGG + Exonic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034296139 7:149973906-149973928 GGTCAGAGGGAGGAGGAGGATGG + Intergenic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034809893 7:154122903-154122925 GGTCAGAGGGAGGAGGAGGATGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034969748 7:155411475-155411497 CCTCAGTGGTAGGTGGGGGACGG - Intergenic
1035121573 7:156572837-156572859 CCCCAGAGGGAGGAGGCTGTGGG - Intergenic
1035599726 8:890564-890586 CCGCAGAGGGAAGGGGAGGAGGG - Intergenic
1035751198 8:1997584-1997606 CCTCCTAGAGGGGCGGCGGAGGG + Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1037910713 8:22742079-22742101 CCTCAGAGGAAGGCCTCTGAAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040413839 8:47180675-47180697 GCTCAGAGGCTGGCGGCGGGAGG + Intergenic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051697923 9:19788953-19788975 CCTCAGAGCGGGTAGGCGGAGGG - Intergenic
1053790011 9:41680064-41680086 GCTGAGGGGGAGGCGGCTGACGG - Intergenic
1054178350 9:61891753-61891775 GCTGAGGGGGAGGCGGCTGACGG - Intergenic
1054474920 9:65565801-65565823 CCTGAGGGGGAGGCGGCTGACGG + Intergenic
1054659179 9:67689071-67689093 GCTGAGGGGGAGGCGGCTGACGG + Intergenic
1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG + Intronic
1057018965 9:91681125-91681147 ACTCACTGGGAGGCTGCGGATGG + Intronic
1060103933 9:120862063-120862085 GCCCAGAGGGAGGCGCCGCAGGG + Intronic
1060205277 9:121678990-121679012 CCTGAGAGGGAGGGGGCAGGTGG + Intronic
1060591052 9:124817236-124817258 CCACTGGGGGAGGCTGCGGAGGG - Intergenic
1061202055 9:129143648-129143670 CCAAAGGGGGAGGGGGCGGAAGG - Intronic
1061407580 9:130400963-130400985 CCACAGAGAGAGGCAGCTGAGGG + Intronic
1061615043 9:131773981-131774003 CCTCACAGTGAGGCTGCCGAGGG - Intergenic
1061938807 9:133873091-133873113 CGACAGAGGGAGGGGGCGGGGGG + Intronic
1062033559 9:134372736-134372758 CCTCAGAGGGTGGCAGCACAGGG + Intronic
1203772757 EBV:57932-57954 GGACAGAGGGAGGCGGCGGCCGG + Intergenic
1185709993 X:2296333-2296355 CCCCAGAGGGAGGGGAGGGAAGG + Intronic
1186979119 X:14939939-14939961 CCACAGTGGGAGGGGGAGGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1195086444 X:101418319-101418341 CTTCAGCGGGAGGCAGCAGAGGG + Intronic
1196297446 X:114015183-114015205 GGACAGGGGGAGGCGGCGGAGGG + Intergenic
1198278308 X:135118022-135118044 CCTTAGATGTAGGCGGGGGAGGG + Intergenic
1198292654 X:135254494-135254516 CCTTAGATGTAGGCGGGGGAGGG - Intronic