ID: 902024076

View in Genome Browser
Species Human (GRCh38)
Location 1:13369898-13369920
Sequence CCAGAGATGAAGCTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 3, 1: 0, 2: 2, 3: 23, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024076_902024086 27 Left 902024076 1:13369898-13369920 CCAGCAGAAAGCTTCATCTCTGG 0: 3
1: 0
2: 2
3: 23
4: 222
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203
902024076_902024080 -5 Left 902024076 1:13369898-13369920 CCAGCAGAAAGCTTCATCTCTGG 0: 3
1: 0
2: 2
3: 23
4: 222
Right 902024080 1:13369916-13369938 TCTGGGCCACAGGAGCCCAGTGG 0: 3
1: 7
2: 13
3: 47
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024076 Original CRISPR CCAGAGATGAAGCTTTCTGC TGG (reversed) Intronic