ID: 902024081

View in Genome Browser
Species Human (GRCh38)
Location 1:13369922-13369944
Sequence TCTCTTCCACTGGGCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 3, 1: 0, 2: 2, 3: 34, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024081_902024086 3 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203
902024081_902024087 9 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024087 1:13369954-13369976 AACTGACCTGAGCAAGGTCTAGG 0: 3
1: 0
2: 7
3: 16
4: 153
902024081_902024091 23 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024091 1:13369968-13369990 AGGTCTAGGGACATCAGCTAGGG 0: 10
1: 2
2: 4
3: 5
4: 98
902024081_902024090 22 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024081_902024088 10 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024088 1:13369955-13369977 ACTGACCTGAGCAAGGTCTAGGG 0: 3
1: 0
2: 8
3: 15
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024081 Original CRISPR TCTCTTCCACTGGGCTCCTG TGG (reversed) Intronic