ID: 902024083

View in Genome Browser
Species Human (GRCh38)
Location 1:13369932-13369954
Sequence TCTTTGGGCATCTCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 3, 1: 0, 2: 1, 3: 25, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024083_902024092 30 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024092 1:13369985-13370007 CTAGGGCTACCTGCTTTCAGAGG 0: 3
1: 0
2: 2
3: 11
4: 121
902024083_902024091 13 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024091 1:13369968-13369990 AGGTCTAGGGACATCAGCTAGGG 0: 10
1: 2
2: 4
3: 5
4: 98
902024083_902024087 -1 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024087 1:13369954-13369976 AACTGACCTGAGCAAGGTCTAGG 0: 3
1: 0
2: 7
3: 16
4: 153
902024083_902024088 0 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024088 1:13369955-13369977 ACTGACCTGAGCAAGGTCTAGGG 0: 3
1: 0
2: 8
3: 15
4: 122
902024083_902024090 12 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024083_902024086 -7 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024083 Original CRISPR TCTTTGGGCATCTCTTCCAC TGG (reversed) Intronic