ID: 902024085

View in Genome Browser
Species Human (GRCh38)
Location 1:13369948-13369970
Sequence CCTTGCTCAGGTCAGTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 3, 1: 0, 2: 0, 3: 14, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024085_902024092 14 Left 902024085 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 14
4: 143
Right 902024092 1:13369985-13370007 CTAGGGCTACCTGCTTTCAGAGG 0: 3
1: 0
2: 2
3: 11
4: 121
902024085_902024094 27 Left 902024085 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 14
4: 143
Right 902024094 1:13369998-13370020 CTTTCAGAGGCTCCCTGACATGG 0: 3
1: 0
2: 3
3: 13
4: 189
902024085_902024091 -3 Left 902024085 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 14
4: 143
Right 902024091 1:13369968-13369990 AGGTCTAGGGACATCAGCTAGGG 0: 10
1: 2
2: 4
3: 5
4: 98
902024085_902024090 -4 Left 902024085 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 14
4: 143
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024085 Original CRISPR CCTTGCTCAGGTCAGTTCTT TGG (reversed) Intronic