ID: 902024086

View in Genome Browser
Species Human (GRCh38)
Location 1:13369948-13369970
Sequence CCAAAGAACTGACCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 3, 1: 0, 2: 0, 3: 18, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024076_902024086 27 Left 902024076 1:13369898-13369920 CCAGCAGAAAGCTTCATCTCTGG 0: 3
1: 0
2: 2
3: 23
4: 222
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203
902024081_902024086 3 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203
902024083_902024086 -7 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203
902024082_902024086 -6 Left 902024082 1:13369931-13369953 CCCAGTGGAAGAGATGCCCAAAG 0: 3
1: 0
2: 1
3: 25
4: 236
Right 902024086 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024086 Original CRISPR CCAAAGAACTGACCTGAGCA AGG Intronic