ID: 902024087

View in Genome Browser
Species Human (GRCh38)
Location 1:13369954-13369976
Sequence AACTGACCTGAGCAAGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 3, 1: 0, 2: 7, 3: 16, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024083_902024087 -1 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024087 1:13369954-13369976 AACTGACCTGAGCAAGGTCTAGG 0: 3
1: 0
2: 7
3: 16
4: 153
902024081_902024087 9 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024087 1:13369954-13369976 AACTGACCTGAGCAAGGTCTAGG 0: 3
1: 0
2: 7
3: 16
4: 153
902024082_902024087 0 Left 902024082 1:13369931-13369953 CCCAGTGGAAGAGATGCCCAAAG 0: 3
1: 0
2: 1
3: 25
4: 236
Right 902024087 1:13369954-13369976 AACTGACCTGAGCAAGGTCTAGG 0: 3
1: 0
2: 7
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024087 Original CRISPR AACTGACCTGAGCAAGGTCT AGG Intronic