ID: 902024088

View in Genome Browser
Species Human (GRCh38)
Location 1:13369955-13369977
Sequence ACTGACCTGAGCAAGGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 3, 1: 0, 2: 8, 3: 15, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024081_902024088 10 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024088 1:13369955-13369977 ACTGACCTGAGCAAGGTCTAGGG 0: 3
1: 0
2: 8
3: 15
4: 122
902024082_902024088 1 Left 902024082 1:13369931-13369953 CCCAGTGGAAGAGATGCCCAAAG 0: 3
1: 0
2: 1
3: 25
4: 236
Right 902024088 1:13369955-13369977 ACTGACCTGAGCAAGGTCTAGGG 0: 3
1: 0
2: 8
3: 15
4: 122
902024083_902024088 0 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024088 1:13369955-13369977 ACTGACCTGAGCAAGGTCTAGGG 0: 3
1: 0
2: 8
3: 15
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024088 Original CRISPR ACTGACCTGAGCAAGGTCTA GGG Intronic