ID: 902024090

View in Genome Browser
Species Human (GRCh38)
Location 1:13369967-13369989
Sequence AAGGTCTAGGGACATCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 10, 1: 5, 2: 1, 3: 10, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902024083_902024090 12 Left 902024083 1:13369932-13369954 CCAGTGGAAGAGATGCCCAAAGA 0: 3
1: 0
2: 1
3: 25
4: 182
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024085_902024090 -4 Left 902024085 1:13369948-13369970 CCAAAGAACTGACCTGAGCAAGG 0: 3
1: 0
2: 0
3: 14
4: 143
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024082_902024090 13 Left 902024082 1:13369931-13369953 CCCAGTGGAAGAGATGCCCAAAG 0: 3
1: 0
2: 1
3: 25
4: 236
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024084_902024090 -3 Left 902024084 1:13369947-13369969 CCCAAAGAACTGACCTGAGCAAG 0: 3
1: 0
2: 0
3: 13
4: 174
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115
902024081_902024090 22 Left 902024081 1:13369922-13369944 CCACAGGAGCCCAGTGGAAGAGA 0: 3
1: 0
2: 2
3: 34
4: 301
Right 902024090 1:13369967-13369989 AAGGTCTAGGGACATCAGCTAGG 0: 10
1: 5
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902024090 Original CRISPR AAGGTCTAGGGACATCAGCT AGG Intronic