ID: 902030122

View in Genome Browser
Species Human (GRCh38)
Location 1:13416246-13416268
Sequence CAGAGCAATGACTTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 2, 2: 5, 3: 29, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902030115_902030122 29 Left 902030115 1:13416194-13416216 CCACTGAGTACAGAGTAGAATTG 0: 5
1: 2
2: 4
3: 7
4: 152
Right 902030122 1:13416246-13416268 CAGAGCAATGACTTTGGCCCTGG 0: 1
1: 2
2: 5
3: 29
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902030122 Original CRISPR CAGAGCAATGACTTTGGCCC TGG Intronic
900090230 1:917091-917113 CAGAGCTCTGACCCTGGCCCAGG - Intergenic
900466940 1:2830295-2830317 CATAGCACTGACTCTGCCCCTGG - Intergenic
900622829 1:3595259-3595281 CAGAGCCATGAATCTGCCCCGGG - Intronic
901961376 1:12828873-12828895 CAGAGCAGTGACTTTGGCCCTGG - Intronic
901962928 1:12841446-12841468 TAGAGAAATGACTTTGGCCCTGG - Intergenic
901975769 1:12942608-12942630 CAGAGCAGTGACTTTGGCCTTGG - Intronic
901985646 1:13073588-13073610 CAAAGCAGTGACTTTGGCCCTGG + Intronic
901990118 1:13105752-13105774 TAGAGAAATGACTTGGGCCCTGG - Intergenic
901996163 1:13153179-13153201 CAAAGCAGTGACTTTGGCCCTGG - Intergenic
902005285 1:13226968-13226990 CAGAACAATCACTTAAGCCCTGG + Intergenic
902007643 1:13245121-13245143 CAGAACAATCACTTGAGCCCAGG - Intergenic
902009405 1:13259157-13259179 CAGAGCAGTGACTTTGGCCTTGG + Intronic
902026616 1:13388920-13388942 CAGAACAATCACTTGAGCCCAGG - Intergenic
902030122 1:13416246-13416268 CAGAGCAATGACTTTGGCCCTGG + Intronic
902281548 1:15378373-15378395 CAGAGCCAGGACTGTGTCCCTGG + Intronic
902302811 1:15514528-15514550 CAGAGCTAGGACTTGGGCCTAGG - Intronic
903014170 1:20351068-20351090 CAGAGCAATCACTGTCTCCCAGG + Intronic
903798923 1:25952086-25952108 AAGAGCACTGACTCTGGGCCCGG + Intergenic
904289355 1:29474151-29474173 TAGAGCCCTGACTTTGGCACAGG + Intergenic
904467114 1:30714718-30714740 CAGAGCAAAGACACAGGCCCAGG + Intronic
904619868 1:31768688-31768710 CAGAGCAATGAGTATTGCCAAGG - Intergenic
905224562 1:36470878-36470900 CAGAGCAGTTACTTTGTGCCAGG + Intronic
905273541 1:36802430-36802452 CAAAGCACTAGCTTTGGCCCAGG + Intronic
905886330 1:41494044-41494066 CAGAGGAATGGCTCTGGCTCTGG - Intergenic
905887712 1:41500595-41500617 CAGAGCCTTGACTTCAGCCCTGG - Intergenic
906298465 1:44663533-44663555 CATAGCAATGACTTTTGGCCAGG - Intronic
907527620 1:55063084-55063106 CAGAGGGATGAGTTTGGCACTGG + Intronic
907541253 1:55216629-55216651 AATAGCAAGGACTTAGGCCCAGG - Intergenic
907573077 1:55501822-55501844 TGGAGCAATGACTTGAGCCCAGG - Intergenic
908730215 1:67218694-67218716 CAGAGAGATGACTTGTGCCCAGG + Intronic
909515374 1:76501364-76501386 CAGAGCAAGGGCTTTATCCCGGG + Intronic
909774750 1:79469494-79469516 CATAGCTTTGACTTTGGCACAGG - Intergenic
915976372 1:160393016-160393038 CAGAGCAAAGAATATTGCCCGGG - Intergenic
916268700 1:162918091-162918113 CACAGCAGTGACTCTGCCCCTGG - Intergenic
916424434 1:164667467-164667489 CAGAGCAATAACTTCGACCCTGG + Intronic
916799491 1:168203173-168203195 CAGAGCAATGAATTTCTGCCTGG - Intergenic
917618741 1:176772947-176772969 CAGAGAAATGTCTTAGGACCAGG + Intronic
917910774 1:179642710-179642732 CAGAGTAATGGCTTTGTGCCTGG + Intronic
919693094 1:200544907-200544929 TAGAGCATGGACTTTGGCCCAGG + Intergenic
920001073 1:202799237-202799259 CAGAAAAATGACTTTGTCCAAGG + Intronic
920335707 1:205243784-205243806 CAGAGCACTGGCCCTGGCCCAGG - Intronic
920628849 1:207631706-207631728 CAGAGCAATTTATTTGGCTCTGG + Intronic
921099721 1:211918161-211918183 CTGAGTAATCACTCTGGCCCTGG + Intergenic
922221691 1:223613287-223613309 TAGAGGAATGACTGTGACCCTGG - Intronic
923102580 1:230828009-230828031 GAGAGAAATGACGCTGGCCCAGG + Intergenic
924639832 1:245823496-245823518 CTGAACAATGCATTTGGCCCAGG - Intronic
1064159346 10:12930624-12930646 CAGGGCAATGACATTGCCACCGG - Intronic
1067779248 10:49187306-49187328 GAGAGCAAAGACTTTGGCCTTGG - Intronic
1069195396 10:65545126-65545148 CAGAGCAATGACTGTGACTGTGG + Intergenic
1070534096 10:77362269-77362291 AAGAACAATGACTTAGCCCCAGG + Intronic
1072124091 10:92430241-92430263 CAGAGCGAAGACTCTGTCCCAGG + Intergenic
1072461434 10:95622427-95622449 CAGAGGAATCACTTTAGCCCAGG - Intronic
1072765515 10:98091809-98091831 CTGAGCAATGACTATGGCCAAGG - Intergenic
1073099748 10:101000261-101000283 CTGAGCAATCACTCTGGCCCAGG - Exonic
1074015261 10:109528165-109528187 CAGTGCCATGACTATGTCCCAGG - Intergenic
1074120325 10:110489277-110489299 CAGAGCAAGGGCTTTGCCCAAGG - Intergenic
1074776697 10:116772440-116772462 CAGAGCTCTGAGTTTGGGCCTGG - Intergenic
1075461404 10:122618875-122618897 CAGAGCACTGCCTGTGCCCCAGG + Intronic
1075545766 10:123353320-123353342 TAGAGCAAGGACTTTTTCCCAGG - Intergenic
1075929830 10:126286388-126286410 GAGATGAATGACTTTGGCTCTGG - Intronic
1076729993 10:132433643-132433665 CAGAGCCATGACTTTGGTGGTGG + Intergenic
1076833510 10:133008557-133008579 CAGAGCAAGCACTTTCGCACTGG - Intergenic
1077984155 11:7333509-7333531 CAGATCTATGAATTTGGCTCTGG + Intronic
1078345245 11:10541876-10541898 CAGAGCAAGGATTTTAACCCAGG + Intergenic
1078356548 11:10636265-10636287 CAGGGCAATCACTTGAGCCCAGG - Intronic
1079285781 11:19130936-19130958 CAGAAGAATCACTTGGGCCCAGG - Intronic
1080458811 11:32436490-32436512 CCGAGCACTGCCTGTGGCCCTGG + Intergenic
1080473589 11:32569915-32569937 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1082067707 11:47914404-47914426 CAGAGCAAGGACTTGAACCCAGG + Intergenic
1082266948 11:50129537-50129559 CAGAGCAAGGACACAGGCCCTGG - Intergenic
1082289141 11:50349031-50349053 CAGAGCAAGGACACAGGCCCTGG + Intergenic
1083274717 11:61590285-61590307 CAGAGCAATGACCTTGGCCCTGG + Intergenic
1083943911 11:65913344-65913366 CAGGGAAGTGCCTTTGGCCCAGG - Intergenic
1084363563 11:68684234-68684256 CACAGCGATGACTTGGGCCACGG + Intronic
1085288863 11:75382882-75382904 CAGAGAAATCACTTGAGCCCAGG - Intergenic
1085324130 11:75593751-75593773 CTGAGCAATAACTATGGGCCAGG + Intronic
1087257543 11:95973337-95973359 CTGAACAATCACTTTGGCCAAGG - Intergenic
1090383771 11:126344744-126344766 GAAAGCATTGACTTTGGCCCTGG - Intronic
1090423095 11:126589103-126589125 CAGAGCAATTACTGCTGCCCTGG + Intronic
1090766846 11:129883738-129883760 CAGAGCCAGGAGTTGGGCCCTGG - Intronic
1091447474 12:552254-552276 AAGAGCAAAGACTTTGGGCTGGG - Intronic
1091723532 12:2830272-2830294 CAGAGCAAAGACGGTGGCCGAGG + Intronic
1095214082 12:39527752-39527774 CATAGAAATGACTTTGGAACTGG - Intergenic
1096380468 12:51153281-51153303 CAGGGGAATAACTTGGGCCCAGG + Intronic
1098432191 12:70432120-70432142 CAGAGGAATGACTTGAACCCAGG - Exonic
1099677469 12:85780199-85780221 CAGAGCAGTGACTTAAGCCTAGG - Intergenic
1101065330 12:101014920-101014942 CAGGGCAATCCCTTAGGCCCAGG - Intronic
1101708686 12:107244668-107244690 CAGAGCCAGGACTTGGGCCCAGG + Intergenic
1101957340 12:109222943-109222965 CAGAGCACACACTGTGGCCCAGG + Intronic
1102752022 12:115303199-115303221 CAGAGCTGTGATTTGGGCCCAGG - Intergenic
1103895394 12:124269772-124269794 CAGATAAAGGAATTTGGCCCAGG + Intronic
1105434923 13:20368199-20368221 CAGAAAAATGACTCTGGCTCAGG + Intergenic
1106701460 13:32233581-32233603 TAAAGCAAAGACTTTGGCACAGG + Intronic
1107101296 13:36596414-36596436 CAGGGGAATCACTTGGGCCCAGG - Intergenic
1107618805 13:42202502-42202524 CAGAACAAAGACTTTGACCTTGG + Intronic
1107826548 13:44333522-44333544 CAGAGCCATGAACTTGGACCAGG - Intergenic
1108509929 13:51147356-51147378 CAGAGCCATGACTGGGACCCAGG - Intergenic
1110054783 13:70953803-70953825 CAGATCTATGGATTTGGCCCTGG + Intergenic
1110995083 13:82097332-82097354 CACAGGAATGAATTTGGCTCTGG - Intergenic
1111707920 13:91774662-91774684 CAGAGCATGGACTTTGGGTCAGG - Intronic
1118161210 14:63292314-63292336 TAGAACAGGGACTTTGGCCCTGG + Exonic
1119170057 14:72528101-72528123 CAGACAAATGACTGGGGCCCTGG - Intronic
1120743902 14:88136835-88136857 CAGAGGTTTGACTTTGGCCTTGG + Intergenic
1121925446 14:97923183-97923205 CAGAGCAAATACATTGGCCATGG - Intergenic
1121964284 14:98289815-98289837 CAGAACAATCACTTGGGGCCAGG - Intergenic
1202943260 14_KI270726v1_random:3152-3174 CAGAGAAATGACTCTGTCCTTGG - Intergenic
1123626433 15:22229927-22229949 GAGAGCCAGGACTTGGGCCCAGG + Intergenic
1125833938 15:42734844-42734866 CAGGACAGTGACTTAGGCCCAGG - Intronic
1127472720 15:59304962-59304984 CAGAGCACTGACCTTGGACAAGG - Intronic
1127845559 15:62867460-62867482 CAGAGCCAGGACTTGAGCCCAGG + Intergenic
1128323000 15:66705659-66705681 TTGAGCAATTACTTTGGGCCAGG + Intronic
1128876008 15:71201910-71201932 CAGAGCAAGGAATCTGGCCTGGG + Intronic
1129381103 15:75167334-75167356 CACATCAATGCATTTGGCCCAGG - Intergenic
1131179567 15:90230723-90230745 CAGAGCAATGACAATGGCAGTGG + Intronic
1132884107 16:2174980-2175002 CACAGCAGTGGCCTTGGCCCTGG + Intronic
1134678783 16:16109402-16109424 CAGGACAATGACTTGAGCCCAGG - Intronic
1135092395 16:19528982-19529004 CAAAGCAATGATTTGGACCCAGG - Intronic
1135729628 16:24883270-24883292 CAGGACAATCACTTGGGCCCAGG + Intronic
1135980695 16:27144520-27144542 CAGAAGAATGACTTGAGCCCAGG + Intergenic
1138337381 16:56263910-56263932 CAGAGCTAAGACTTAGACCCCGG + Intronic
1138378600 16:56584448-56584470 CAAAGCACTGACTTTAGGCCAGG - Intergenic
1138771278 16:59666999-59667021 CACAGCAAGGACTTAGGCCCAGG - Intergenic
1138934677 16:61704686-61704708 CAGAGAAGTGACTTTGGACAAGG - Intronic
1141478496 16:84290294-84290316 CACAGCCATGACTTTGGCCTTGG + Intergenic
1141854988 16:86674653-86674675 CAGAGCAAGGACTTTCGCACAGG - Intergenic
1142343867 16:89541679-89541701 CAGAGCAGTCCCTTTGGCCCTGG - Intronic
1142550317 17:734244-734266 CAGAAAAATGACTTGAGCCCAGG - Intronic
1143882451 17:10040059-10040081 CTGAGCACTCACTTTGGACCAGG + Intronic
1146134518 17:30307192-30307214 CAGAACAATGCCTGTGGCACAGG - Intergenic
1146604903 17:34249824-34249846 CAGAGCCAGGCCTTTGGCCCTGG + Intergenic
1146768069 17:35542210-35542232 CAGAGGAATCACTTGAGCCCGGG - Intergenic
1150374397 17:64668356-64668378 CAGAGGAATCACTTGAGCCCAGG + Intergenic
1150374718 17:64671505-64671527 CAGAGGAATCACTTGAGCCCAGG + Intergenic
1150778016 17:68097435-68097457 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1150831430 17:68523435-68523457 CAGAATAATGACCTTGGTCCAGG + Intronic
1152331977 17:79678780-79678802 CAGAGCAATGCCATTTTCCCAGG + Intergenic
1153539356 18:6137085-6137107 CAGAGGAAAGAGTTTGTCCCAGG - Intronic
1155620164 18:27769043-27769065 CAAAGCAATGACTGTGGACTGGG + Intergenic
1155792522 18:29991851-29991873 CATAGCACTGACTTTTGCCAAGG + Intergenic
1157389963 18:47293399-47293421 CAGAGCTGTGACTTTGTCACTGG - Intergenic
1159265791 18:66076680-66076702 CTGAACAATGACTTTGGGCCAGG - Intergenic
1160988479 19:1851083-1851105 CAGTGCAATCACCTTGGCCCTGG - Intergenic
1162647934 19:12063800-12063822 CAGGAGAATCACTTTGGCCCAGG - Intergenic
1162865701 19:13545057-13545079 CATACCCATGACTTTGGCCTTGG + Intronic
1164742376 19:30585480-30585502 TAGAGCCATGACTGTGGCCCTGG + Intronic
1166135380 19:40773932-40773954 CATAGCAATGGCTGTGGGCCTGG + Intronic
1168320585 19:55507249-55507271 CAGAAGAATCACTTGGGCCCTGG + Intronic
927057459 2:19379248-19379270 CAGATCAATGACTGAGGGCCTGG + Intergenic
928637382 2:33261654-33261676 CAGATTAATGACTGTGGCACTGG + Intronic
929654594 2:43717697-43717719 CAGAGCCAGGACTTGTGCCCAGG - Intronic
931941158 2:67253552-67253574 CAAAGCAATGCCTTGGGTCCAGG + Intergenic
932446455 2:71784756-71784778 CAGCCCAAGGACTTTGGCCTTGG - Intergenic
932704791 2:74015097-74015119 CAGAGGAATGACTTGGCCCAAGG + Intronic
935889855 2:107664345-107664367 CAGAGGAAAGAATTTGGCCTAGG - Intergenic
937220994 2:120343382-120343404 GAGAGCAGAGACTCTGGCCCTGG + Intergenic
937812781 2:126217522-126217544 GAGAGCCATGGCTTTGTCCCAGG - Intergenic
938606247 2:132895541-132895563 CACAGCAATGACTCCAGCCCTGG - Intronic
938688488 2:133764201-133764223 AAGAGCAAGGACTTAGGCCATGG + Intergenic
938695467 2:133831352-133831374 AACAGCAATGACTATGGACCAGG - Intergenic
940643014 2:156366896-156366918 CCGACCAATGAGTTTGGCCAGGG + Intergenic
944469950 2:200042248-200042270 CCAAGAAATGACTCTGGCCCTGG - Intergenic
946089609 2:217209066-217209088 CTGAGCAAAGTCTCTGGCCCTGG - Intergenic
947599485 2:231437198-231437220 GAGAGCGCTGACTGTGGCCCTGG + Intergenic
1169067147 20:2700492-2700514 GAGATCAAAGACTTTGGCCTTGG + Intronic
1171065312 20:22009329-22009351 CAGAAGAATGACTTTAGGCCAGG - Intergenic
1171316864 20:24203059-24203081 CAGAGCACTGACTGTGTCCCAGG + Intergenic
1173924118 20:46768159-46768181 CAGAGCCATGACTTGGGCTGAGG - Intergenic
1175669022 20:60885600-60885622 CAGAGCAAATGCTCTGGCCCAGG + Intergenic
1178138958 21:29660077-29660099 ATGAGCAATGACTGTGTCCCAGG - Intronic
1181377594 22:22472355-22472377 CAGAAGAATCACTTTAGCCCAGG + Intergenic
1181768621 22:25110390-25110412 CAGAGCCCTGACTCTGGGCCAGG + Intronic
1183243692 22:36677265-36677287 CAGATCAAATAATTTGGCCCTGG - Intronic
1184249265 22:43250945-43250967 CAGGGCTGGGACTTTGGCCCAGG + Intronic
1184397726 22:44254451-44254473 CAGGGGAATCACTTTAGCCCAGG - Intronic
1184629040 22:45761382-45761404 CAGAGCACTCACTGTGGGCCCGG - Intronic
1185087469 22:48748675-48748697 CAGAGCAGTGACTGGCGCCCAGG + Intronic
949759302 3:7451606-7451628 TAGAGCAATGATGATGGCCCAGG - Intronic
950163630 3:10777910-10777932 CACAGTGAGGACTTTGGCCCTGG - Intergenic
951589675 3:24249869-24249891 AACAGCAATTACTTTTGCCCCGG - Intronic
956641114 3:71416450-71416472 CAGAAGAATCACTTTAGCCCAGG + Intronic
956725536 3:72153539-72153561 CTGAGCAGTGACTCTGGGCCAGG + Intergenic
957305758 3:78456685-78456707 CGGAGCAATGATTTTAACCCTGG + Intergenic
959585560 3:108022144-108022166 CAGAGGAAAGAATTTGGCCAAGG + Intergenic
960239932 3:115328866-115328888 CAGAGAAAAGATTTTTGCCCAGG + Intergenic
960283955 3:115806915-115806937 AACAGAAATGACTTTGACCCAGG - Exonic
960738371 3:120804926-120804948 CTGAGCACTGACTCTGGGCCTGG - Intergenic
960896297 3:122509151-122509173 CAGAACAATGGCTTAAGCCCAGG + Intronic
961524483 3:127488091-127488113 CAGACCAATCACTGTGGCCAGGG - Intergenic
961945255 3:130680180-130680202 CAGAGCACCTACTTTGGCCCAGG + Intronic
962812383 3:138970877-138970899 CAGGGCAAAGACTCTAGCCCTGG + Intergenic
963139440 3:141935489-141935511 CAGACCAATCACTTGAGCCCAGG + Intergenic
963785062 3:149526081-149526103 CAGAGCACTGACAGTGGCCTGGG - Exonic
964947402 3:162243075-162243097 CAGAGCTATGACTTGATCCCAGG - Intergenic
966198225 3:177334849-177334871 GAGACAAATAACTTTGGCCCTGG - Intergenic
967779503 3:193419858-193419880 CACAGCTATCACTTGGGCCCTGG - Intronic
967828004 3:193894274-193894296 CAGAGAGATGAGTGTGGCCCAGG - Intergenic
968203700 3:196779761-196779783 CAGAGGAATCACTTGAGCCCGGG - Intronic
969185011 4:5468403-5468425 CAGAGCCAGGACTTGGCCCCAGG - Intronic
969228309 4:5813225-5813247 CATAGAAATCACTTTTGCCCAGG + Exonic
969757785 4:9161368-9161390 CAGAGCTCTGCCTGTGGCCCTGG + Intergenic
975837763 4:78442394-78442416 CAAAGCAATGGCTTTTGCCTGGG + Intronic
977405328 4:96590540-96590562 CAGAGCTATGATTTTTGTCCAGG - Intergenic
977635287 4:99291407-99291429 CAGAGGAATGTGTTTGGCTCAGG + Intergenic
977719911 4:100227846-100227868 CAAATCAATGAGTATGGCCCTGG - Intergenic
978402639 4:108347208-108347230 AAGAAAAATGACATTGGCCCAGG + Intergenic
979617317 4:122758319-122758341 CAGAGCCAGGACTCTGACCCTGG - Intergenic
979795897 4:124846485-124846507 CAGAGCTATGACTTGGGGCGAGG + Intergenic
985873383 5:2577001-2577023 CAGGGCAATGGGTCTGGCCCTGG + Intergenic
986034520 5:3925094-3925116 CAGAGCAAAGCCTTTGGAGCAGG + Intergenic
986344542 5:6822695-6822717 GAGGGCAATGACTCTGGCCAAGG - Intergenic
988583586 5:32489910-32489932 CAGAGAAGTGACTTGGGCCTGGG + Intergenic
989664239 5:43834582-43834604 CAGAGCCAAGACTGTAGCCCAGG + Intergenic
990956335 5:61343984-61344006 CAGAAGAATCACTTTAGCCCAGG - Intronic
991588138 5:68220512-68220534 CAGAGGAATGACCCTGGCCCAGG - Intronic
992280223 5:75167407-75167429 CAGAGAAATGGCCTAGGCCCTGG - Intronic
992555001 5:77894186-77894208 CAGAGGAATCACTTGAGCCCGGG + Intergenic
993385196 5:87253933-87253955 CTGAGCATTAACTTTGGCCCAGG + Intergenic
995199792 5:109413258-109413280 CAGTGCAAAGACTTTTCCCCAGG + Intergenic
995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG + Intergenic
997248469 5:132370712-132370734 CAGAGCCAGGACTTGGGCCAGGG + Intronic
997299786 5:132794483-132794505 GAGAGCAATGACTTTATTCCAGG + Intronic
998039628 5:138944163-138944185 CAGGGCAAGGGCTCTGGCCCTGG - Intergenic
998098954 5:139416044-139416066 CAGAGCAATGACCTTGTACAAGG + Intronic
998385575 5:141755334-141755356 CAGGGCTCTGACTTTGGCCCAGG + Intergenic
999100164 5:149017200-149017222 CCGAGCATTTACTATGGCCCAGG - Intronic
999136738 5:149325475-149325497 TAGAGCAAAGGCTTTGCCCCAGG + Intronic
999193173 5:149763756-149763778 CAGAGAAATGACTTGAGCCCAGG - Intronic
999337469 5:150734756-150734778 CAGGGCCAAGATTTTGGCCCAGG - Intronic
999565230 5:152852242-152852264 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1001568304 5:172714472-172714494 CAGAGCACAGATTTTGTCCCTGG + Intergenic
1001624739 5:173121955-173121977 CAGGGGAATGGCTTTAGCCCAGG - Intronic
1001889809 5:175329414-175329436 CACAGCACAGACCTTGGCCCTGG - Intergenic
1002135917 5:177107459-177107481 CAGAGAGAGGACTTTGGCCAGGG - Intergenic
1002314959 5:178337570-178337592 CAGAGCAGGGAGTCTGGCCCTGG - Intronic
1002887268 6:1308820-1308842 CAGAGCCATGCATTTTGCCCTGG + Intergenic
1004322845 6:14646322-14646344 CAGAGGAATCACTTTAACCCGGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1006267721 6:32939101-32939123 CAGAGCTTTGTCTTTGACCCTGG + Intronic
1006383631 6:33716309-33716331 CAGAGCCAGGACTTGAGCCCAGG + Intergenic
1006904889 6:37526567-37526589 CAGAGGAAGGACTGGGGCCCTGG - Intergenic
1006936561 6:37722896-37722918 CAGATCAGAGCCTTTGGCCCAGG - Intergenic
1007024634 6:38558030-38558052 CAGGACAATTACTTTAGCCCAGG + Intronic
1007284805 6:40739948-40739970 CAGAGCACTCATTTTGGGCCAGG + Intergenic
1010050877 6:71502874-71502896 CAGAGTAAGGACTTTAGCTCTGG + Intergenic
1010266289 6:73871955-73871977 CAGAACCATGATTTTGCCCCAGG + Intergenic
1010832916 6:80553046-80553068 CAGAGTAAAGTCTTTTGCCCTGG - Intergenic
1014050932 6:116953559-116953581 CAGGGCCATGACTTGGGCCCTGG + Intergenic
1016987517 6:149906206-149906228 GTGAGCATTGAATTTGGCCCAGG + Intergenic
1017503945 6:155050342-155050364 CAAAACAATGACTTTGGAGCTGG + Intronic
1018371637 6:163173854-163173876 CAGAGCGATGCCTTTGGCTATGG - Intronic
1019105135 6:169661245-169661267 CTGAGCAGTGGCCTTGGCCCAGG - Intronic
1019515541 7:1438319-1438341 CAGAGCAGGGACATTGGCCGGGG + Exonic
1022511362 7:30936883-30936905 CAAAGCAAGGACTCAGGCCCAGG - Intergenic
1024934982 7:54702689-54702711 GTGGGCAATCACTTTGGCCCAGG - Intergenic
1027219380 7:76204242-76204264 AAGAGCTATGATTTTGTCCCTGG - Intronic
1028418367 7:90604940-90604962 CAGATCAATGAGTGTGGCTCAGG - Intronic
1031637208 7:124116537-124116559 CAGAGGAAAGAATTTGGCCAAGG + Intergenic
1037078178 8:14748450-14748472 CAGAGCAAGAATTTTGCCCCAGG + Intronic
1038216675 8:25567954-25567976 CAGATCAAGAACTTTGGCCTTGG + Intergenic
1038568861 8:28642351-28642373 CAGGACAATCACTTGGGCCCAGG + Intronic
1040384337 8:46903550-46903572 CAGAGCAGGGACTCTGTCCCTGG - Intergenic
1041585199 8:59508857-59508879 CAGAGCAATGACTTATTCCAGGG - Intergenic
1043684674 8:83070759-83070781 TAGACCAATGAGTTTGTCCCTGG - Intergenic
1044473910 8:92604385-92604407 AAGATCAAGGACTTTGACCCTGG + Intergenic
1046112475 8:109742063-109742085 CAGAGCAATTACTTTGTGCCAGG + Intergenic
1048193852 8:132315470-132315492 CTGAGCTATGACCTTGGCTCGGG + Intronic
1048336614 8:133507401-133507423 AAGAGCATAGGCTTTGGCCCAGG + Intronic
1048477469 8:134756455-134756477 GAGGGCAGTGAGTTTGGCCCTGG - Intergenic
1048973978 8:139661110-139661132 CACTGCAGTGACTTTGGCCTGGG - Intronic
1050042877 9:1514216-1514238 CAGAAGAAACACTTTGGCCCAGG + Intergenic
1052627342 9:30993393-30993415 TAGAGCACTGACTTTGTACCAGG - Intergenic
1054712935 9:68529676-68529698 CTGAGCACTCTCTTTGGCCCTGG - Exonic
1055554905 9:77464091-77464113 TAGGGCAATGACTTGAGCCCAGG - Intronic
1056004911 9:82258589-82258611 CAGAGGAAAGAATTTGGACCTGG - Intergenic
1056808400 9:89745822-89745844 TAGAGCTATGTCCTTGGCCCAGG - Intergenic
1057142859 9:92738101-92738123 CAGAGCCAGGACGTGGGCCCAGG - Intronic
1057183311 9:93041256-93041278 CAGACCAATCACTGTGGCCAAGG - Intergenic
1059150345 9:111943850-111943872 AAGAAAAATGACTTTGGGCCAGG - Intergenic
1060176187 9:121499237-121499259 CAGAGGAATGGCTCTTGCCCAGG - Intergenic
1060526086 9:124322113-124322135 CAGAGCCATGCCTGTGGCCCAGG + Intronic
1186406899 X:9312649-9312671 CAGGGCAATCGCTTGGGCCCAGG + Intergenic
1187705578 X:22006354-22006376 CAGAGGACTGTCTTTGGCTCAGG + Intergenic
1192550187 X:72047436-72047458 GGGAGCAATGGCTATGGCCCAGG + Intergenic
1192581631 X:72287765-72287787 AAGAGCAAAGATTTTGGGCCAGG + Intronic
1193603579 X:83538800-83538822 CAGAGCTAGGATTTTGACCCAGG - Intergenic
1194955324 X:100172576-100172598 CAGAGTCATGGCTTTGTCCCAGG + Intergenic
1194988152 X:100513516-100513538 CAGGGCAATGAGTCTGGCCCTGG + Intergenic
1195944964 X:110199889-110199911 CAGAGTAATTAGTTTGGACCTGG - Intronic
1196656816 X:118227220-118227242 CAGAGCAATGCCTCTGCCCCCGG - Intergenic
1198395296 X:136213614-136213636 CAGAGCAGTGTCTTTGGTGCTGG - Intronic
1199247597 X:145625095-145625117 CAGTTCACTGACTCTGGCCCCGG - Intergenic
1200776771 Y:7176475-7176497 CCCAGCATTGACTTTGCCCCAGG + Intergenic
1202244657 Y:22807802-22807824 CACAGCAATGTCTGTGGCCAAGG - Intergenic
1202397646 Y:24441548-24441570 CACAGCAATGTCTGTGGCCAAGG - Intergenic
1202473135 Y:25228539-25228561 CACAGCAATGTCTGTGGCCAAGG + Intergenic