ID: 902031339

View in Genome Browser
Species Human (GRCh38)
Location 1:13424793-13424815
Sequence ACTCATCCTGTTACACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902031339_902031341 26 Left 902031339 1:13424793-13424815 CCAGAATGTGTAACAGGATGAGT No data
Right 902031341 1:13424842-13424864 TACAATAACATCATGCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902031339 Original CRISPR ACTCATCCTGTTACACATTC TGG (reversed) Intergenic
No off target data available for this crispr