ID: 902036662

View in Genome Browser
Species Human (GRCh38)
Location 1:13462937-13462959
Sequence ATGTTCCAAGCAGAGAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036662_902036670 24 Left 902036662 1:13462937-13462959 CCCTTATTCTCTGCTTGGAACAT No data
Right 902036670 1:13462984-13463006 TCATACTCACCCACGAAGCCGGG No data
902036662_902036669 23 Left 902036662 1:13462937-13462959 CCCTTATTCTCTGCTTGGAACAT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036662 Original CRISPR ATGTTCCAAGCAGAGAATAA GGG (reversed) Intergenic
No off target data available for this crispr