ID: 902036663

View in Genome Browser
Species Human (GRCh38)
Location 1:13462938-13462960
Sequence AATGTTCCAAGCAGAGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036663_902036669 22 Left 902036663 1:13462938-13462960 CCTTATTCTCTGCTTGGAACATT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036663_902036670 23 Left 902036663 1:13462938-13462960 CCTTATTCTCTGCTTGGAACATT No data
Right 902036670 1:13462984-13463006 TCATACTCACCCACGAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036663 Original CRISPR AATGTTCCAAGCAGAGAATA AGG (reversed) Intergenic
No off target data available for this crispr