ID: 902036664

View in Genome Browser
Species Human (GRCh38)
Location 1:13462965-13462987
Sequence ATGAGGCACAGAGGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036664_902036670 -4 Left 902036664 1:13462965-13462987 CCTGCCCTGCCTCTGTGCCTCAT No data
Right 902036670 1:13462984-13463006 TCATACTCACCCACGAAGCCGGG No data
902036664_902036669 -5 Left 902036664 1:13462965-13462987 CCTGCCCTGCCTCTGTGCCTCAT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036664 Original CRISPR ATGAGGCACAGAGGCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr