ID: 902036665

View in Genome Browser
Species Human (GRCh38)
Location 1:13462969-13462991
Sequence GAGTATGAGGCACAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036665_902036669 -9 Left 902036665 1:13462969-13462991 CCCTGCCTCTGTGCCTCATACTC No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036665_902036670 -8 Left 902036665 1:13462969-13462991 CCCTGCCTCTGTGCCTCATACTC No data
Right 902036670 1:13462984-13463006 TCATACTCACCCACGAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036665 Original CRISPR GAGTATGAGGCACAGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr