ID: 902036666

View in Genome Browser
Species Human (GRCh38)
Location 1:13462970-13462992
Sequence TGAGTATGAGGCACAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036666_902036670 -9 Left 902036666 1:13462970-13462992 CCTGCCTCTGTGCCTCATACTCA No data
Right 902036670 1:13462984-13463006 TCATACTCACCCACGAAGCCGGG No data
902036666_902036669 -10 Left 902036666 1:13462970-13462992 CCTGCCTCTGTGCCTCATACTCA No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036666 Original CRISPR TGAGTATGAGGCACAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr