ID: 902036669

View in Genome Browser
Species Human (GRCh38)
Location 1:13462983-13463005
Sequence CTCATACTCACCCACGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902036664_902036669 -5 Left 902036664 1:13462965-13462987 CCTGCCCTGCCTCTGTGCCTCAT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036662_902036669 23 Left 902036662 1:13462937-13462959 CCCTTATTCTCTGCTTGGAACAT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036665_902036669 -9 Left 902036665 1:13462969-13462991 CCCTGCCTCTGTGCCTCATACTC No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036663_902036669 22 Left 902036663 1:13462938-13462960 CCTTATTCTCTGCTTGGAACATT No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data
902036666_902036669 -10 Left 902036666 1:13462970-13462992 CCTGCCTCTGTGCCTCATACTCA No data
Right 902036669 1:13462983-13463005 CTCATACTCACCCACGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902036669 Original CRISPR CTCATACTCACCCACGAAGC CGG Intergenic
No off target data available for this crispr