ID: 902037492

View in Genome Browser
Species Human (GRCh38)
Location 1:13468236-13468258
Sequence CAGGGTGGACAGTTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902037484_902037492 30 Left 902037484 1:13468183-13468205 CCTGGGTGACAGAGCGAGACTCG 0: 181
1: 19401
2: 94583
3: 144972
4: 155171
Right 902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902037492 Original CRISPR CAGGGTGGACAGTTTGAGGA AGG Intergenic
No off target data available for this crispr