ID: 902037492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:13468236-13468258 |
| Sequence | CAGGGTGGACAGTTTGAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 902037484_902037492 | 30 | Left | 902037484 | 1:13468183-13468205 | CCTGGGTGACAGAGCGAGACTCG | 0: 181 1: 19401 2: 94583 3: 144972 4: 155171 |
||
| Right | 902037492 | 1:13468236-13468258 | CAGGGTGGACAGTTTGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 902037492 | Original CRISPR | CAGGGTGGACAGTTTGAGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||