ID: 902038283

View in Genome Browser
Species Human (GRCh38)
Location 1:13473462-13473484
Sequence GCTGAAGGGGAGAAAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902038277_902038283 -7 Left 902038277 1:13473446-13473468 CCAGAGTCTCCTCTAGGCTGAAG 0: 1
1: 0
2: 3
3: 11
4: 212
Right 902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 500
902038276_902038283 -6 Left 902038276 1:13473445-13473467 CCCAGAGTCTCCTCTAGGCTGAA 0: 1
1: 0
2: 2
3: 14
4: 201
Right 902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902038283 Original CRISPR GCTGAAGGGGAGAAAAGAGT GGG Intergenic
900300232 1:1973426-1973448 GCTGAAGGGAAGGAATGAGATGG + Intronic
900592557 1:3466567-3466589 GCTGAAGGGGAGCCATGTGTTGG + Intronic
900940902 1:5798092-5798114 GCTGATGGGGAGAGAGGAGGTGG + Intergenic
901437995 1:9261299-9261321 GATGGAGGTGAGCAAAGAGTGGG - Intronic
901521296 1:9787041-9787063 GCTGCAGGGGTGAGAAGAGAAGG + Intronic
901720939 1:11196995-11197017 GGTGAAGGGAAAATAAGAGTAGG + Intronic
902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG + Intergenic
902912221 1:19608177-19608199 GCTGAAGGGGAGAATGTATTTGG + Intronic
903862153 1:26370998-26371020 GCTGGACGGGAGGACAGAGTAGG + Intronic
904697361 1:32337776-32337798 GCTGAGGGTGAGAAAAGGCTTGG + Intergenic
904748924 1:32728760-32728782 GCTGGAGGGGAGAAAAGCTGAGG + Intergenic
905174343 1:36126395-36126417 GCAGCAGGGGAGAAAGGAGGAGG + Intergenic
905723885 1:40231691-40231713 GCTGGAGGAAAGAAATGAGTGGG + Intronic
906406040 1:45542889-45542911 GCTGAAGGGCTGAACAGAGCTGG + Intergenic
907489514 1:54800207-54800229 GGTGAGGGGGAGAGAAGAGGTGG + Intronic
907517394 1:55001176-55001198 GCTGATTGGGAGAACACAGTGGG + Intronic
907699298 1:56767582-56767604 GGTAAAGGGGAGAAAAGAAGAGG + Intronic
907924300 1:58941572-58941594 GCTGAAGGAGAGGACAGACTGGG - Intergenic
908033066 1:60021815-60021837 GCTGAAGGGGAACAAAGGATGGG + Intronic
909663001 1:78104656-78104678 GCTAAAGGGGAGAAGGGAGAAGG + Intronic
910025614 1:82647505-82647527 GCTGGAGGCGGGAAGAGAGTGGG - Intergenic
910724693 1:90326570-90326592 GGAGAAGGGGAGAAGAGAGAAGG - Intergenic
910792282 1:91063926-91063948 TCTGAAGAGGAGAAAAGACTTGG - Intergenic
912369376 1:109161872-109161894 ACTGCAGGGGAGAGAACAGTGGG - Exonic
912775576 1:112504546-112504568 TGTTAAGGGGGGAAAAGAGTGGG - Intronic
913284822 1:117216619-117216641 GCTAAAGGCCAGAAATGAGTTGG + Intergenic
913363927 1:118014605-118014627 GCTGAAGAGGAAAAAATATTTGG + Intronic
913390829 1:118310100-118310122 TCTGAAAGGAAAAAAAGAGTTGG - Intergenic
913547538 1:119884428-119884450 GCTTAATGGGAGAAAATGGTTGG - Intergenic
914227109 1:145729656-145729678 ACAGAAGTGGAGAAAATAGTTGG - Intronic
914827011 1:151144028-151144050 GCTGAAGAAAGGAAAAGAGTAGG + Intronic
914840989 1:151248595-151248617 GCTGAAGGAATGAAGAGAGTGGG + Intronic
915202714 1:154244695-154244717 GCTAAACGGAAGAAATGAGTAGG + Intronic
915449522 1:155994892-155994914 GCTGGGGTGGAGAGAAGAGTAGG + Intronic
915829486 1:159113316-159113338 GCTGAAGGAGAGAGAAATGTAGG - Intronic
915964593 1:160295216-160295238 GAGGAGGTGGAGAAAAGAGTGGG + Intronic
916727039 1:167532798-167532820 GATGAAGAGGAGGAAAGAGGAGG + Intronic
916729124 1:167550858-167550880 GCTGCAGGGAACAAAAGAGTAGG + Intronic
916756377 1:167774191-167774213 GCTGGAGTGGGGAAAAGAGAAGG - Intronic
917187987 1:172383153-172383175 GGGGCAGGGGAGAAGAGAGTGGG - Intronic
917361873 1:174185310-174185332 ACTGAGGTGGAGAAAAGTGTAGG + Intronic
918427024 1:184420994-184421016 GCTGAAAGAGGGAAAAGAGATGG + Intronic
918682402 1:187371855-187371877 GCTGAAGGAAAGAAACCAGTAGG + Intergenic
919355159 1:196512981-196513003 GGTGATGGGAAGAAGAGAGTGGG - Intronic
920092401 1:203464010-203464032 GCCGGAGGGGAGGAAAGGGTTGG + Intergenic
920150532 1:203902756-203902778 GGTGAAGGGGAGAGAAGAATGGG - Intergenic
920565624 1:206970450-206970472 CCTGAAGGGGACACAAGAGGAGG - Exonic
921516635 1:216100420-216100442 GCTTAAGAGAAGAAAAGAGTTGG - Intronic
921523081 1:216181395-216181417 GCTGAAGGGGATAAACCAGAGGG - Intronic
921557564 1:216616804-216616826 GCACAACGGGAGGAAAGAGTAGG + Intronic
921582948 1:216916059-216916081 GCTGAAAGGGAGAGGAGAGTGGG - Intronic
922132149 1:222790492-222790514 GCAGCAGGCGAGAAAAGAGCAGG - Intergenic
922283692 1:224149753-224149775 TCTGAAGGGGAATAAAGGGTTGG + Intronic
923738587 1:236635199-236635221 GCTGGAGGGAAGAACAGAGCTGG + Intergenic
1062951119 10:1504312-1504334 GCTTCATGGGAGAAAACAGTAGG - Intronic
1063871318 10:10420662-10420684 GCAGAATGGGAGAAAATATTTGG - Intergenic
1063879508 10:10516928-10516950 GCGGAAGGAGAAAAAAGAGGTGG - Intergenic
1064588440 10:16863802-16863824 GTTGAAGGGGATAAAAAAGAAGG - Intronic
1064706345 10:18076275-18076297 CTTGGAGGGGAAAAAAGAGTGGG + Intergenic
1066564825 10:36710539-36710561 GCTGGAAGGGGGAATAGAGTAGG - Intergenic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1068248569 10:54406465-54406487 GCAGAAGAGGAGAAAGGAGGAGG - Intronic
1070592611 10:77811554-77811576 GTTGAAGGGCAGAAAAGAAGGGG - Intronic
1070754795 10:78985404-78985426 GCTGAAGTGGAGGGAAGACTTGG - Intergenic
1070814577 10:79314728-79314750 GTTGAAGGGGTGAACAGAATGGG + Exonic
1071275234 10:84048296-84048318 ACTGAAGGGGAGGCAAGAGTGGG - Intergenic
1071295997 10:84220304-84220326 GCTGAAGGTGACAGAAGAGGAGG + Intergenic
1072051448 10:91707950-91707972 TCTGAAGGGGACAGAAGAGAGGG - Intergenic
1072774277 10:98173705-98173727 GGTTAGGGGGAAAAAAGAGTAGG - Intronic
1073010514 10:100355681-100355703 GCAGAAATGGAGAAAAGAGTTGG + Intronic
1073297799 10:102451377-102451399 GCTGAAGGAGACAAGTGAGTGGG - Exonic
1073576963 10:104634423-104634445 GGAGAAGGGGAGAATAGAGGAGG - Intergenic
1073708147 10:106010430-106010452 TGGAAAGGGGAGAAAAGAGTGGG - Intergenic
1073746716 10:106477504-106477526 GGAGAAGGAGAGAAAAGAGGAGG - Intergenic
1074005548 10:109419383-109419405 GCTGAAAGGGAGAAGAGACTGGG - Intergenic
1074794507 10:116928160-116928182 GCTGAAGGGTAGGAAGGAGTAGG + Intronic
1075740676 10:124694189-124694211 GCTGAAGAGGAGAAGAGCCTGGG + Intronic
1076464509 10:130669298-130669320 GCTGGCGTGGAGAAAGGAGTAGG + Intergenic
1078478339 11:11653802-11653824 GATGAGGGGGAAAAGAGAGTTGG + Intergenic
1079701279 11:23551726-23551748 GCAGAAGAGGAGAAGAGAGTGGG - Intergenic
1079923504 11:26461433-26461455 GATGAAGGTGTGAAAGGAGTGGG - Intronic
1080557098 11:33427779-33427801 ACTGCAGGGGAGAGAAGAGAGGG - Intergenic
1080714275 11:34783663-34783685 GCTGAAGTTGAGAAGAGAGAAGG - Intergenic
1080786347 11:35478427-35478449 TCTGAAGGGGAGGGCAGAGTTGG + Intronic
1080790338 11:35516946-35516968 GGGGAAGGGGAAAAAAGAGGTGG + Intronic
1081062750 11:38501349-38501371 GCAGAATGGGAGAAAACATTTGG - Intergenic
1081163581 11:39782676-39782698 GCTGAAGGGAATAAAATAGAAGG + Intergenic
1083069090 11:59958261-59958283 GCAGAATGGGAGAAAATACTTGG + Intergenic
1083080364 11:60086231-60086253 GCTGAAGGGAACCAAAGTGTGGG + Intergenic
1083595815 11:63917811-63917833 GCTGCAGGGGAGAGAGGAGCTGG + Intergenic
1083876266 11:65525765-65525787 GCAGGAGGGGAGACAGGAGTGGG - Intronic
1083921793 11:65785252-65785274 GCCGTTGGGGAGAACAGAGTTGG - Intergenic
1084565578 11:69926617-69926639 GCTGGAGGGGAGGAAGGAGATGG + Intergenic
1084597253 11:70124328-70124350 GCTGAGGGGGAGGAAGCAGTGGG - Exonic
1085214607 11:74817820-74817842 GTGGAAGGGGAGAAAAGAGGTGG + Intronic
1085353727 11:75816868-75816890 GCTAAAGGGAAGAGAAGAGTTGG + Intronic
1085973358 11:81621574-81621596 GCTGAGGAGGAGAAAAGAAGAGG - Intergenic
1086220599 11:84438151-84438173 GCTGGGGAGGAGAAAAGAGAAGG - Intronic
1087299363 11:96414031-96414053 GGGAAAGGGGAGGAAAGAGTGGG + Intronic
1087693240 11:101346265-101346287 GGAGAAGGGCAGGAAAGAGTGGG + Intergenic
1088547778 11:110978259-110978281 GGTGGAGGGGAGAAGGGAGTGGG + Intergenic
1088712848 11:112523990-112524012 GCTGGAGGGGAGAAAAAACCTGG + Intergenic
1089268333 11:117282889-117282911 GCTGGAGGTGAGGAAGGAGTGGG + Intronic
1089785357 11:120903513-120903535 GGAAAAGGGGAGAAAAGAGGAGG - Intronic
1089980141 11:122765491-122765513 GGTGAAGGGGAACAAAGAGTTGG + Intronic
1091363672 11:134999590-134999612 GCTGGAGGGAAGGAGAGAGTGGG - Intergenic
1091663223 12:2399772-2399794 GAGGCAGGGAAGAAAAGAGTGGG - Intronic
1093426908 12:19038035-19038057 GCTGAAGGGCAGAAATTAATAGG + Intergenic
1093637410 12:21488011-21488033 TATGAAGGGAAGAAGAGAGTGGG - Intronic
1094125539 12:27019018-27019040 GATGAAGGTGAGATTAGAGTGGG - Intergenic
1095627179 12:44329661-44329683 GCACAAGGGGAGAAAGGAATGGG - Intronic
1095971194 12:47903097-47903119 GCCGAAGAGGAGTAAAGGGTTGG + Intronic
1096430174 12:51536785-51536807 GCTGAAGGGGTGAAGTGAGGAGG + Intergenic
1096790787 12:54043535-54043557 GCTGACGGGAAGAATGGAGTGGG - Intronic
1096864985 12:54557225-54557247 GCAGAAGGGGAGAGAATAGGAGG - Intronic
1097008168 12:55933524-55933546 GCTGAAGGGCAGCAAACTGTGGG - Intronic
1097223149 12:57461978-57462000 CCTGAAGGGGAGATATGGGTGGG + Intronic
1098125915 12:67292830-67292852 CCAGAAGGGGAAAAAAGGGTGGG - Intronic
1098286967 12:68917097-68917119 GCTGGAGGGGAGAAAGGAGAAGG - Intronic
1099403857 12:82235399-82235421 GCAAAAGAGGAGAAAAGAGGGGG - Intronic
1099491434 12:83292932-83292954 TGTAAAGGGGAGGAAAGAGTGGG + Intergenic
1100233901 12:92638035-92638057 GCTGGAGGAGGGATAAGAGTAGG - Intergenic
1100661774 12:96707515-96707537 TGTGAAGGGGAGGAAAGAATGGG + Intronic
1101018060 12:100522696-100522718 GGAGGAGGGGAGAAAAGTGTGGG - Intronic
1101303997 12:103509195-103509217 GCTGAATGGCACAAATGAGTAGG - Intergenic
1101725893 12:107387938-107387960 GAAGAAGAGGAGAAAAGAGAAGG - Intronic
1102218272 12:111177294-111177316 GCTGCAGGGGGGAAAAGTGGGGG - Intronic
1102370196 12:112376628-112376650 GCTAAAGGGGAGAGGAGAGATGG - Intronic
1102430938 12:112882289-112882311 GCTTGAGGGGAGAGAAGGGTGGG - Intronic
1102976022 12:117207748-117207770 GAAGAAGGAGAGAAAAGAGGAGG - Intergenic
1103919426 12:124391656-124391678 GTAGATGGAGAGAAAAGAGTGGG - Intronic
1104234219 12:126917412-126917434 GTTTAAGGAGAGAAAAGAGCAGG + Intergenic
1104343697 12:127976781-127976803 GAAGAGGGGGAAAAAAGAGTTGG - Intergenic
1105590098 13:21784816-21784838 CCTGAAGGGGAGAAAAATGGTGG + Intergenic
1105908221 13:24834973-24834995 GCTGATGGGGGGAACACAGTGGG + Intronic
1106203145 13:27561366-27561388 GAGGGAGGGGAGAAAAGAGGAGG - Intronic
1106203944 13:27571443-27571465 GCTTAAAGGAAAAAAAGAGTTGG + Intronic
1106816034 13:33408306-33408328 GCTGGAGGGGAGAGGAAAGTGGG - Intergenic
1107204304 13:37763413-37763435 GAGGAAGAGGAGAAAAGAATTGG + Intronic
1107424024 13:40275202-40275224 GCTGAAGAGGAGAACAAAGCAGG + Intergenic
1107752455 13:43583110-43583132 GCATAAGGGAAGAAAAGACTAGG + Intronic
1108742061 13:53348470-53348492 GCAGAAGGGAAGAAAAGAGCAGG + Intergenic
1109837630 13:67879335-67879357 GATGAAGGTGACAAAAGATTTGG + Intergenic
1109984758 13:69965463-69965485 GGAGAAGGGGAGAAATGAGGGGG - Intronic
1109993573 13:70091305-70091327 GTTGAAAGAGAAAAAAGAGTTGG - Intronic
1110321322 13:74163042-74163064 TCTGAAGGAGAGAAAAGGGAAGG + Intergenic
1111047936 13:82840154-82840176 ACAGAAGGCAAGAAAAGAGTTGG - Intergenic
1111961419 13:94814670-94814692 GCTGAGGGGGAAAAACAAGTTGG + Intergenic
1112044951 13:95587352-95587374 GTTGAAGGAGAGGAAGGAGTTGG - Intronic
1113677254 13:112215311-112215333 GCTGGAGGGGAGAAGGGAGATGG + Intergenic
1113760006 13:112840475-112840497 GCTGGAGGGGACAGGAGAGTAGG - Intronic
1113760027 13:112840540-112840562 GCTGGAGGGGACAGGAGAGTAGG - Intronic
1114791337 14:25661819-25661841 ACTGATGTGGAGACAAGAGTTGG - Intergenic
1114987922 14:28252833-28252855 TGGAAAGGGGAGAAAAGAGTAGG - Intergenic
1115027821 14:28764556-28764578 CCTGAAGAGGGGAGAAGAGTGGG + Intergenic
1115661561 14:35499877-35499899 GAGGAAGGGGAGAAAAGAAGAGG - Intergenic
1115689408 14:35827268-35827290 ACTGAAGGGAAGAAAAGACTTGG - Intronic
1115749976 14:36479607-36479629 TTTGAAGGGGAGGACAGAGTAGG - Intronic
1115965571 14:38884032-38884054 GCTGCAGGGTAGAATGGAGTGGG - Intergenic
1116093312 14:40335979-40336001 GCTTACTGGGAGAAATGAGTTGG + Intergenic
1116590916 14:46771327-46771349 GCTGTTGTGGAGAAAAGTGTTGG - Intergenic
1117543974 14:56775743-56775765 GCTGAATGGGACAAAAGCGATGG + Intergenic
1117988633 14:61412856-61412878 GCAGAAAGGAAGAAAAGAGATGG - Intronic
1118116901 14:62788654-62788676 GCTGAAGGGTGGAATAGAGGGGG - Intronic
1119163291 14:72471180-72471202 GATGAAAGGAAGAAAAAAGTTGG + Intronic
1119649673 14:76374815-76374837 GCTGAAGTGGAGGAACAAGTGGG - Intronic
1119698913 14:76737068-76737090 GCCGAATGGGAGAAAATATTTGG - Intergenic
1120713318 14:87815530-87815552 GCCGGAAGGGAGGAAAGAGTGGG - Intergenic
1121307322 14:92915209-92915231 GCTGATGAGGGGATAAGAGTGGG + Intergenic
1121535973 14:94690933-94690955 GCTGCGGAGGAGAAAATAGTTGG + Intergenic
1124905160 15:33861544-33861566 GCTGAAAGGGAAAAAGAAGTAGG - Intronic
1127572596 15:60258957-60258979 CCTGAAGGGGAGGTAGGAGTGGG - Intergenic
1127951023 15:63806567-63806589 GCTGAAAGGGACAAAAGAGTAGG - Intronic
1127997538 15:64162525-64162547 GCTTAAGGAGAGAAAGGATTCGG + Intronic
1128684990 15:69677398-69677420 GCTGAAGAAGAGAAGAGGGTTGG + Intergenic
1129338721 15:74871138-74871160 GCTGAAAGGCAGAAAGGTGTGGG + Intronic
1130195518 15:81777096-81777118 CTTGAAAGGGAGAAAAGAGAAGG + Intergenic
1131027669 15:89158455-89158477 GCTGAAGAGCAGAGAAGAATAGG + Intronic
1131498512 15:92936450-92936472 TCTGTAGGTGAGAAATGAGTGGG + Intronic
1131960182 15:97782006-97782028 GGGGAAGGGGAAAAAAGAGTTGG - Intergenic
1133231615 16:4369689-4369711 GCTGGAGGGGAGGACAGAGGAGG - Intronic
1134742155 16:16557507-16557529 GCTGAAGGGGTGAAAAAGGGAGG - Intergenic
1134925407 16:18154949-18154971 GCTGAAGGGGTGAAAAAGGGAGG + Intergenic
1137024838 16:35462820-35462842 GCTGTAGGGAAGAACAAAGTTGG - Intergenic
1137542524 16:49374737-49374759 GATGTAGGGTAGAAAAGAGGAGG - Intronic
1140509038 16:75494386-75494408 CCTGAAGAGCAGAAAGGAGTTGG - Intronic
1141381094 16:83577651-83577673 GCTGAGGAGGAGAAAGGGGTAGG + Intronic
1141587905 16:85047391-85047413 GCTGAAGGGGTGAAGATAGGAGG - Intronic
1141911635 16:87063590-87063612 GATGATGGGGAGAAAAATGTGGG - Intergenic
1141988554 16:87595822-87595844 GCTGAGGAGGAGAAGAGAGAAGG + Intergenic
1142288092 16:89179592-89179614 GCAGGAGGGGAGAAAGGGGTAGG + Intronic
1142293516 16:89204048-89204070 GCAGAATGGGAGAAAATATTTGG - Intergenic
1142788506 17:2244512-2244534 GATGAAGGGAAGAGAAGAGAAGG + Intronic
1142874401 17:2842800-2842822 GCTGGAGGGGAGGAGAGGGTGGG - Intronic
1142876793 17:2856103-2856125 GCTGAAGGGCAGAAAACAGAAGG - Intronic
1142970334 17:3606979-3607001 GCTGCATGAGAGAGAAGAGTAGG - Intergenic
1143381400 17:6498500-6498522 GCTGAAGGGAGGATCAGAGTGGG + Intronic
1143658753 17:8312256-8312278 GCTGAGGGGGGCAAAAGAGCAGG - Exonic
1144205165 17:12974583-12974605 GAGGAAGGGGAAAACAGAGTTGG - Intronic
1144508073 17:15850402-15850424 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1144877706 17:18411066-18411088 GGTGAAGGGAAGAAAAGGATGGG - Intergenic
1145154523 17:20533337-20533359 GGTGAAGGGAAGAAAAGGATGGG + Intergenic
1145172195 17:20668040-20668062 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1145202401 17:20958122-20958144 GCTGAATTGGAGAAATGAGAGGG - Intergenic
1145727162 17:27140813-27140835 GCAGAAGAGGAGAAAGGAGGAGG - Intergenic
1146489969 17:33273849-33273871 GCAGAATGGGAGAAATGACTGGG + Intronic
1146736021 17:35239915-35239937 ACTAAAGAGGAGAAGAGAGTTGG - Intergenic
1146823634 17:36004456-36004478 GCTAAAGGCAAGAAGAGAGTGGG + Intergenic
1146941157 17:36845391-36845413 GCAGAAGGGAAAACAAGAGTGGG + Intergenic
1147704229 17:42414939-42414961 GGTGTAGGGGAGAAAAGTGGGGG - Intronic
1148738755 17:49880299-49880321 GTTCAAAGGGAGAAAAGAGCCGG - Intergenic
1148913522 17:50955913-50955935 GCTGAAAGGGAGAAAAGGAGGGG - Intergenic
1149361666 17:55901761-55901783 GCAGTAGGTGAGAGAAGAGTTGG + Intergenic
1150007020 17:61476312-61476334 CCAGAAGGTGAGAAAAGAATGGG + Intronic
1150518051 17:65835522-65835544 CCTGAAGGCCAGAAGAGAGTAGG + Intronic
1150558716 17:66276647-66276669 GCAGAAGGGGAAAATGGAGTTGG + Intergenic
1150824647 17:68463760-68463782 GCTGGAGTGGGGAGAAGAGTGGG + Intergenic
1151113749 17:71709060-71709082 TCTGAATGGGAGAAAATACTTGG - Intergenic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1153115905 18:1655838-1655860 GCTGAAGAAGAGAAAAGAAGTGG + Intergenic
1153893134 18:9536486-9536508 GCAGAAGGAGAGAGGAGAGTGGG - Exonic
1154980131 18:21496969-21496991 GATTAAGGGTAGAAAAGACTAGG - Intronic
1156930965 18:42642801-42642823 ATTTAAGGGGAAAAAAGAGTTGG - Intergenic
1158380084 18:56920045-56920067 GGTGAAGGGGAGAAGAGGGCGGG - Intronic
1158536891 18:58316272-58316294 GCTGAAGTGCAGAAAAGAGAGGG - Intronic
1158825722 18:61216468-61216490 TCTGATGGAGAGAAAAGAGGTGG - Intergenic
1159933087 18:74334320-74334342 GAGGAAGGGGAGAAAAGAGGAGG + Intronic
1160384842 18:78489612-78489634 ACTGAAGTGGAGGAAAAAGTAGG + Intergenic
1160474374 18:79168926-79168948 GCTGGAGAGGAGAAGAGAGAAGG - Intronic
1161415785 19:4145623-4145645 GAGGAAGGGGAGGAAAGAGAAGG + Intergenic
1161475927 19:4485158-4485180 GCTTGAGGGGAGAAGAGAATTGG - Intronic
1162567456 19:11451990-11452012 GCTGCAGGGGAGAGGAGAGAGGG + Exonic
1162752861 19:12839115-12839137 GCTGAGGGGTAGAAAAAAGGGGG + Intronic
1162917404 19:13881747-13881769 GCAGGAGGGGAGGAAAGAGCAGG - Intergenic
1163199047 19:15749415-15749437 GCAGTAGGTGAGACAAGAGTAGG - Intergenic
1164555680 19:29249077-29249099 GCTGAAAGGGAGAGGAGAGCAGG - Intergenic
1164700532 19:30281155-30281177 GAGGAAGGGGAGACAAGAGCAGG - Intronic
1164969315 19:32517549-32517571 GATGAAGAGGAGAGAAGATTTGG - Intergenic
1165790596 19:38489369-38489391 GCAGAAGGGGAGAAAGAAGAAGG + Exonic
1167041168 19:47023261-47023283 GCTGAAGGGGGGGAAAGGGGGGG + Intronic
1167115424 19:47486793-47486815 GCTGCAGGGGAGAGAGGAGCAGG + Intergenic
1167563263 19:50239346-50239368 ACTGAAGGAGAGTAAAGAGATGG - Intronic
925298102 2:2791687-2791709 GGAGAAGGGAAGAGAAGAGTGGG - Intergenic
925577242 2:5373182-5373204 GTTTAAGGGGAGAAAAGTGTGGG - Intergenic
925789342 2:7468000-7468022 GAAGAAGGGGAGAATAGATTTGG + Intergenic
925933161 2:8727228-8727250 GCGGAAGGGAAGAAACCAGTGGG - Intronic
926010609 2:9403231-9403253 TCTGAAATGGAGAAAAGTGTAGG - Exonic
926382293 2:12302630-12302652 TCTGAATGGGTGAAAGGAGTTGG - Intergenic
926771993 2:16386589-16386611 GTTCCAGGGGAGTAAAGAGTTGG + Intergenic
926846615 2:17147879-17147901 GGAGAAGGGGAGCAAAGAGAGGG + Intergenic
927808487 2:26168990-26169012 GCTGGAGGGGAGGAAAAAGTAGG - Intergenic
928093101 2:28388301-28388323 GCTGAAAGGGAGGGAGGAGTTGG - Intergenic
928436394 2:31257282-31257304 GCTGAAGGGAAGATAAAAATAGG + Intronic
928980770 2:37133344-37133366 GCAGAAGAGGAGAAATGAGAGGG - Intronic
929189404 2:39125196-39125218 GCTAAAGGTGAGTAAAGAGTGGG - Intergenic
929247779 2:39721418-39721440 GCTGAAGGGGAGAAAAAAATTGG - Intergenic
929415488 2:41743036-41743058 GGGGAAGGGGAGGTAAGAGTAGG - Intergenic
929575182 2:43047113-43047135 GCTGAAGGGGTGAAAAGGTCTGG + Intergenic
929730947 2:44491255-44491277 GCTGGAGGGGATAGAAGAGGTGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930746850 2:54893386-54893408 GCTGAAGGGCCAATAAGAGTGGG + Intronic
930989975 2:57641385-57641407 GCTGAAGGAGAGCAAATAATTGG + Intergenic
931406852 2:61987899-61987921 GGAGAAGGGGAGGAAAGAGTGGG - Intronic
931746366 2:65294907-65294929 GCTCAAGGGAATAAAAGAGGGGG + Intergenic
931751810 2:65337482-65337504 GGTGGAGGGGAGAGATGAGTAGG - Intronic
932269006 2:70392492-70392514 GGGGAAGGGGAGAAGAGGGTGGG + Intergenic
932471306 2:71961313-71961335 GCTATAGGAGAGAAAAAAGTAGG - Intergenic
932525636 2:72464188-72464210 GCTGATGGGAAAAAAAGTGTTGG - Intronic
933252492 2:80044628-80044650 GCTGAAGGAGAGTCCAGAGTGGG - Intronic
933344995 2:81072029-81072051 GAAGAAGGGGAGAAAAGGTTTGG + Intergenic
933719976 2:85391537-85391559 GGTCAGGGGGAGAAGAGAGTGGG - Exonic
933862879 2:86487644-86487666 GGTGATGGGGAGTTAAGAGTGGG - Intronic
935054779 2:99556102-99556124 GCAGAAGGGGAGAAAGGCTTGGG + Intronic
935064126 2:99633439-99633461 GCTGGAGGGGAGGAAAGAAAAGG + Intronic
935526328 2:104172282-104172304 GCTGAAGAGCAGAATAGAGAGGG + Intergenic
936236069 2:110743833-110743855 GCAGAAGAGGAGAAATGTGTAGG - Intronic
936839024 2:116746930-116746952 GCTGAAAGGGAGTAATGATTAGG - Intergenic
937206700 2:120241192-120241214 GCCCAAGGGGAGAACAGAGGTGG + Intronic
937305471 2:120867860-120867882 GCTGGAGGGGAGGAGAGAGAGGG + Intronic
939353764 2:141074205-141074227 GCAGAAAGGGAGAAAATACTTGG - Intronic
940017785 2:149124824-149124846 GCGGGAGGTGGGAAAAGAGTTGG - Intronic
940756326 2:157687130-157687152 GCAGAAGGGGAAAAAATTGTTGG + Intergenic
942368475 2:175255811-175255833 TGGGAAGGGGAGAAAAGGGTAGG + Intergenic
942989146 2:182178434-182178456 GGTGTAAGGGAGAAAAGAGTTGG + Intronic
943151905 2:184124581-184124603 TCTGAAGTGCAGAATAGAGTTGG - Intergenic
943479390 2:188398862-188398884 GCTAAAGGAGGGAGAAGAGTAGG + Intronic
944046231 2:195414504-195414526 GGGAAAGGGGAGGAAAGAGTAGG + Intergenic
944511595 2:200471356-200471378 GCTGAAGTGGAAAAGAGGGTGGG - Intronic
945082111 2:206096821-206096843 GCTGAAGGGGAGAAAGTTGTGGG - Intergenic
946326275 2:218986036-218986058 GCTGGAGGGGAGATGAGAGTCGG - Intergenic
946482482 2:220070410-220070432 GCTGAAGGGGAGCAAGGGGTTGG - Intergenic
947708455 2:232294921-232294943 GCTGATGGGAAGAAAACAGAAGG - Intronic
947935035 2:233997415-233997437 GGTGAATGGGAGCAAAGAGAGGG - Intronic
948348480 2:237319204-237319226 GCTGCAGGGGAGCACAGAGGCGG - Intergenic
948937685 2:241178196-241178218 ACTGAAGGGGAGCAGAAAGTGGG - Intronic
1170282600 20:14667781-14667803 GCTATAGGAGAGAAGAGAGTGGG - Intronic
1170731087 20:18975305-18975327 GCGGGAGGGAAAAAAAGAGTAGG - Intergenic
1170899876 20:20452313-20452335 GCTGGAGGGGTTAAAAGTGTGGG + Intronic
1172202105 20:33133658-33133680 GGTGATGAGGAGGAAAGAGTTGG + Intergenic
1173422035 20:42909976-42909998 GCTGCTAGGGAGAAAAGAATAGG - Intronic
1173912601 20:46681410-46681432 GGAGAAGGGGAGAAAAGAAAGGG + Intronic
1174458078 20:50663664-50663686 AATGAAGGGGAGAAAATAGGTGG - Intronic
1174734804 20:52955848-52955870 GCTCCATGGGAGAAAAGATTGGG + Intergenic
1175194274 20:57231609-57231631 GCTGCAGTGGAGAACAGAGATGG - Intronic
1175907967 20:62391111-62391133 TCTGCAGGGGAGAAGAGAGAAGG + Exonic
1177045489 21:16163679-16163701 GCTTGAGGGGAGAACAGAGTTGG + Intergenic
1178527704 21:33346215-33346237 GGTTATGGGGAGAAAAGAGATGG + Intronic
1179437680 21:41373569-41373591 GCTGAAGGGCAGAGGGGAGTTGG - Intronic
1180198387 21:46210655-46210677 GCTGAGGCTGAGAAAAGAGAAGG + Intronic
1180286998 22:10756432-10756454 CCAGAAGGGGAGAAAATAGAAGG + Intergenic
1180642331 22:17309380-17309402 AGTGAAGGGGAGAAGAGCGTGGG - Intergenic
1181767585 22:25102918-25102940 CCTGAAAGAGAGAAAAAAGTAGG + Intronic
1182299292 22:29328895-29328917 GCTGCAGGGGAGAGAGGGGTCGG + Exonic
1182444423 22:30381825-30381847 GCTGGAGGAGAGAAGAGAGCAGG - Intronic
1182526151 22:30921513-30921535 GGGGAAGGGGAGAAGAGAGAAGG + Intergenic
1183272328 22:36869922-36869944 GCTTAAGGTGAGACAACAGTTGG - Intronic
1183353293 22:37345190-37345212 GTTGAAGAGGAGAAAAGACTGGG - Intergenic
1183564186 22:38601412-38601434 GCTGAGGGGCAGAAATGAGGTGG + Intronic
1185288097 22:50011228-50011250 GCTGGAGGGGAGAGGAGAGGAGG - Intronic
949234236 3:1789529-1789551 GCTGAATGGGAGAACAGGGTGGG + Intergenic
949568602 3:5269526-5269548 TCAGAAGTGGAGAAAGGAGTTGG - Intergenic
949831746 3:8222179-8222201 TTTGAAGAGGAGAAAAGAGCTGG + Intergenic
950142548 3:10625388-10625410 GCTGCAGGGGAGATAAGAACGGG + Intronic
950976924 3:17256548-17256570 CATGAAGGGGAGAAAATAATGGG + Intronic
951800804 3:26594011-26594033 ACTGAATGGGAGAAAATATTGGG - Intergenic
951824214 3:26849664-26849686 CCTGAAGGAGAGATAAAAGTGGG - Intergenic
953405744 3:42658982-42659004 GCTGGAGGGTGGAGAAGAGTTGG + Exonic
954256396 3:49410382-49410404 GTTGGAGGGAAGAAGAGAGTAGG - Intronic
954491770 3:50913349-50913371 GCTTAAGGAAAGGAAAGAGTGGG - Intronic
955540566 3:59971924-59971946 ACTGAATGGGAGAAATGAGATGG - Intronic
956587201 3:70877437-70877459 GCTGAACAGTAGCAAAGAGTTGG + Intergenic
958996608 3:100912960-100912982 GATGAAGGGGAGAAGGGAGAGGG + Intronic
959326112 3:104938396-104938418 GCTGAAAGGGGGAAAACACTGGG + Intergenic
960616798 3:119603211-119603233 ACTGAAGGGGCCAAAAGAGAGGG + Intronic
960929071 3:122825870-122825892 GAGTAATGGGAGAAAAGAGTTGG + Intronic
960940419 3:122929470-122929492 GCAGGAAGGGAGAAAAGATTTGG + Intronic
961409092 3:126705092-126705114 GCTGAAGGAGAGAGAACAGCCGG - Intronic
961986291 3:131138328-131138350 TAGGAAGGGGAGGAAAGAGTGGG + Intronic
962736629 3:138331257-138331279 ACTGAATGCAAGAAAAGAGTAGG - Intergenic
962851788 3:139313594-139313616 GCTTCAGGGGAGAAAAGAGCAGG + Intronic
963123875 3:141797728-141797750 GCAGACGGGGAGAAAGGAGCCGG - Intronic
963657906 3:148082721-148082743 TCTGAAGGGGAGAAAGCATTTGG - Intergenic
967928905 3:194675692-194675714 GAGGAAGGAGAGGAAAGAGTGGG + Intergenic
969027902 4:4189230-4189252 GCTGTAGGGATGGAAAGAGTTGG - Intronic
969985939 4:11210910-11210932 GTTGAAAGGGAGAAAATAGATGG + Intergenic
970559108 4:17265621-17265643 GGTGGAAGGGAGAAAAGAATGGG - Intergenic
971110634 4:23581463-23581485 AATGAAGGGATGAAAAGAGTTGG - Intergenic
971383429 4:26120951-26120973 GATGAAGGGGGGAAAGGAGAGGG + Intergenic
972056383 4:34807726-34807748 GTTGGAGGGGAGAGAAGAGTAGG - Intergenic
972351701 4:38242260-38242282 GCTGATGGGGGAAAAAGAGGAGG - Intergenic
972968628 4:44544607-44544629 TCTGAGGGGGAGAAAATAGACGG + Intergenic
973151768 4:46897257-46897279 GGTGGTGGGGAGAAAGGAGTTGG - Intronic
974282987 4:59823639-59823661 GAGAAAGGGAAGAAAAGAGTTGG + Intergenic
975551932 4:75621993-75622015 GGTGGAGGGGAGAAAGGAGGGGG + Intronic
975929419 4:79500677-79500699 CTAGAAGGGGAGAAAAAAGTGGG + Intergenic
976137034 4:81949657-81949679 AATAAAGGGGAGAAAAGAGAAGG - Intronic
976697969 4:87938213-87938235 GCTGAAGGAGAAGAAAGAATGGG - Intergenic
978959439 4:114658426-114658448 CTTGGAGGAGAGAAAAGAGTGGG + Intronic
979222407 4:118243362-118243384 GCTGTAGAGGACAAAGGAGTAGG + Intronic
979452574 4:120890207-120890229 GCTGAAGGTGAAAAAGGAGCAGG + Intronic
979565013 4:122145401-122145423 GAGGAAAGGGAGAAAAAAGTGGG - Intergenic
979667560 4:123328917-123328939 AGTGAAGGGGAGAAAAGAATAGG - Intergenic
979878563 4:125925843-125925865 GCTGTAGGGGAGAAATAAATTGG - Intergenic
980203301 4:129684330-129684352 CCTGAAGGGAAGAAAAAAGATGG + Intergenic
980628192 4:135403675-135403697 GCTGAAGAATAGACAAGAGTAGG - Intergenic
980657735 4:135811737-135811759 GCTTAAGGAGAGGAAAGATTAGG + Intergenic
982545281 4:156725150-156725172 GAAGAAGGAGAGAAAAGAGAAGG + Intergenic
983704999 4:170646557-170646579 GCAGAATGGGAGAAAATATTTGG - Intergenic
983714264 4:170757596-170757618 ACTGAAAGGGAGAAAATATTTGG - Intergenic
984594830 4:181655334-181655356 ATTGCAGGAGAGAAAAGAGTCGG + Intergenic
984834799 4:184009899-184009921 GCGGAAGGAGTAAAAAGAGTAGG + Exonic
985060119 4:186069662-186069684 GCTGGAGGGGAGACAGGAGCTGG + Intronic
985800686 5:2003864-2003886 GCTGAGGCGGAGGAAAGAGGGGG + Intergenic
985987590 5:3529687-3529709 GGAGAAGGAGAGAAAAGAGGGGG - Intergenic
986276693 5:6281417-6281439 GCTGTAAGGGAGAAAGAAGTAGG + Intergenic
987043425 5:14084721-14084743 CCTCAAGGGGAGAAACGAGAAGG + Intergenic
987688158 5:21231641-21231663 GATCAAGGGGACAAAAGAGGTGG + Intergenic
988483137 5:31646114-31646136 GGTGAAAGGGACAAAAGAGTTGG - Intronic
988550700 5:32198306-32198328 GGGAAAGGGGAGAAATGAGTAGG + Intergenic
988704626 5:33712586-33712608 ACAGAGGTGGAGAAAAGAGTTGG + Intronic
989273996 5:39565597-39565619 GGTGAAAGGAAGAAAAGAGGAGG - Intergenic
990738406 5:58888517-58888539 GGGGAAGGGGAGAAATGACTGGG - Intergenic
990966151 5:61450206-61450228 GTTGGAGGGGAAAAATGAGTGGG - Intronic
991583197 5:68177796-68177818 GCTGATGGGGAAGAATGAGTAGG + Intergenic
992105102 5:73443963-73443985 GGAGAAGGGGAGAAAAGCGTCGG + Intergenic
992205628 5:74427819-74427841 GGTTAAGGGGAGTAAGGAGTTGG + Intergenic
993483578 5:88454053-88454075 CCTGAATTGGAGAAAAGACTTGG + Intergenic
993869238 5:93231791-93231813 TCTGAAGGGAAGGAAAGAGTTGG + Intergenic
993977084 5:94496031-94496053 GAAGAAGGGAAGACAAGAGTAGG + Intronic
994582364 5:101660366-101660388 GCAGAAGAGCAGAAGAGAGTGGG + Intergenic
996007947 5:118446064-118446086 GGTAAAGAGGAGAAAAAAGTGGG - Intergenic
996696587 5:126403581-126403603 GCTCTAGGGGAAAAAAGAGCAGG + Intronic
997353546 5:133247911-133247933 GCTGAAGGGGCCTAGAGAGTAGG + Intronic
997636971 5:135418014-135418036 GCTTGGGGGGAGAAGAGAGTGGG - Intergenic
997689108 5:135813659-135813681 TCTGAATTGGAGAAGAGAGTTGG + Intergenic
998265233 5:140663105-140663127 GCAGAAGGGAAGAAAAGGGAAGG - Intergenic
998512656 5:142726255-142726277 GCTTAAGGGGAGAGAGGACTGGG - Intergenic
998835114 5:146195963-146195985 ACTGAAGGGGGCAAAAGAGGAGG - Intergenic
998932160 5:147193461-147193483 GCAGAAGGGAAAAAAAGAGAGGG + Intergenic
999617922 5:153444712-153444734 GCTGAAGGGGAAAAAGCAGTTGG + Intergenic
999627227 5:153533522-153533544 GGTGAAGGGGTTTAAAGAGTGGG - Intronic
1000414712 5:160971707-160971729 GCAGAATGGAACAAAAGAGTTGG - Intergenic
1000772615 5:165375317-165375339 GCTGAAGGCGAGAAGAAAGTAGG + Intergenic
1001106406 5:168858336-168858358 TCTGAAGGAGACAAAGGAGTGGG - Intronic
1001289417 5:170446063-170446085 GCTCAAGGGTAGGAAAGAGAGGG - Intronic
1001359843 5:171071953-171071975 GCTGAATGGGAGAAAACATTTGG + Intronic
1002048480 5:176555501-176555523 GCTGGAGGGGAGGCAAGAGCAGG - Intronic
1002655497 5:180743458-180743480 TCTGAAGGGGAGGAAAGAGATGG - Intergenic
1002876293 6:1213527-1213549 GCTCAAGGGGAGAAAAAGCTGGG + Intergenic
1003054528 6:2806269-2806291 GCTAAAGGCAAGAAAGGAGTTGG - Intergenic
1003661608 6:8067620-8067642 GCAAAGGAGGAGAAAAGAGTAGG + Intronic
1004089888 6:12489986-12490008 ACTGAAGGGAAGAAATGTGTAGG + Intergenic
1004594598 6:17087074-17087096 GGGGAAGGGGAGTAAAGGGTTGG - Intergenic
1005708609 6:28481865-28481887 GTAGAAGGGGAGAAAGGAGTGGG - Intergenic
1005774610 6:29117048-29117070 ACTGAAGGGAAGAAAATAGGTGG + Intergenic
1006019604 6:31110319-31110341 GTGGGAGGGGAGAAAGGAGTAGG - Intergenic
1006315778 6:33290670-33290692 GCAGAAAGGGAGAAATTAGTAGG - Intronic
1006528822 6:34632025-34632047 AGTGAATGGGAGAAAAAAGTAGG + Intronic
1006823380 6:36916092-36916114 GGGGAAGGGGAGAAGAGAGAAGG - Intronic
1006881076 6:37340647-37340669 GAAGAAGGGGAGCAGAGAGTCGG - Intergenic
1006967987 6:38009265-38009287 GTGGAAGGGGAGAAAATACTAGG + Intronic
1006970843 6:38043449-38043471 GGTGGAGGGGAGAGAAGAGACGG - Intronic
1007340245 6:41186599-41186621 GGGGAAGAGGAGAAAAGAGATGG + Intergenic
1007353602 6:41294028-41294050 GCTGAAGGGGAGAGAAAGCTGGG + Intergenic
1007701098 6:43767142-43767164 GGGGAAGGGGAGAAAGGGGTGGG - Intergenic
1007902930 6:45428399-45428421 TCTGAGGGGGAGAAAAGGTTGGG - Intronic
1008145349 6:47885191-47885213 TCTTAAGGGTAAAAAAGAGTTGG + Intronic
1008259035 6:49342541-49342563 GGTGAAAAGGAGAAGAGAGTGGG - Intergenic
1008478403 6:51958459-51958481 TCAGAAGGAGAGAAAAGTGTAGG - Intronic
1008876056 6:56329356-56329378 GCTGTGGGGGAGGAAAGAGATGG + Intronic
1011508482 6:88074085-88074107 GCTAAAGGGGAGAAAGGCCTAGG + Intergenic
1012280014 6:97317015-97317037 GCTGAAGCCCAGAATAGAGTGGG + Intergenic
1012641155 6:101616110-101616132 GCTAAAAGGTAGAAAAGAGAAGG - Intronic
1012664626 6:101952093-101952115 GCTGAAATGGAGAACAGATTAGG - Intronic
1013429067 6:110039940-110039962 GCTGAGGGGAAGTAAAGAGAGGG - Intergenic
1013612177 6:111805850-111805872 GTTGAAGTGGAAAAAAAAGTAGG + Intronic
1013613537 6:111819169-111819191 GATTAAGGGGAGAGAAGAGAAGG - Intronic
1013617223 6:111855599-111855621 GATGACGGGGACAAAAGAGAAGG - Intronic
1014511032 6:122322628-122322650 GCTGAAGAGGAGAAATCAGAGGG + Intergenic
1015053245 6:128868253-128868275 GCTGAGGTGGAGAGAAGAGATGG - Intergenic
1015754436 6:136593378-136593400 GCAGATGGGGAAGAAAGAGTAGG + Intronic
1017669008 6:156752340-156752362 TCTGAAGGAGAGAAAACAGTAGG + Intergenic
1017840956 6:158222598-158222620 GGTCAAGGGAAGAAAAGGGTGGG + Intergenic
1018470742 6:164095833-164095855 GATGAAGGTGAGAAAAAAGTAGG + Intergenic
1018648733 6:165972961-165972983 GGGGAAGGGGAGAAGAGAGAAGG - Intronic
1018671196 6:166178678-166178700 GATCCAGGGGAGAAAAGAGCAGG - Intergenic
1019018747 6:168900410-168900432 GCTGCAGGGGTGAGAAGAGGAGG + Intergenic
1019832248 7:3343484-3343506 GCTAAAGAGCAGAAGAGAGTAGG + Intronic
1019908521 7:4083344-4083366 ACTGCATGGGGGAAAAGAGTGGG - Intronic
1020080032 7:5282222-5282244 GAGGAGGGGGAGAAAAGAGGAGG + Intronic
1021216784 7:17925774-17925796 GAAGAAGGGGAAAAAAGAGGAGG + Intronic
1021570177 7:22057112-22057134 ACTGTATGGGAGAAAAAAGTGGG - Intergenic
1021897909 7:25255032-25255054 GGTGATGGGGAGAAATGAGATGG - Intergenic
1022096904 7:27146882-27146904 TCTGAAGGGCAGAAAGGAGAGGG + Intronic
1023204636 7:37734627-37734649 TCAGAAGAGGAGAAAAGAGAAGG + Intronic
1023978095 7:45047669-45047691 GCTGAGGTGGAGAACAGATTAGG + Intronic
1024450054 7:49529131-49529153 ACTGAGGAGGAGAAAAGAGAGGG + Intergenic
1024810981 7:53212049-53212071 TCTAAAGGGGAGAAATCAGTAGG - Intergenic
1024829802 7:53437358-53437380 GCAGAAGGGATGAAAAGAGCAGG + Intergenic
1025160530 7:56655341-56655363 GAGAAAGGAGAGAAAAGAGTAGG + Intergenic
1025198884 7:56949994-56950016 GAGGAGGGGGAGAAAAGAGGAGG - Intergenic
1025673062 7:63626939-63626961 GAGGAGGGGGAGAAAAGAGGAGG + Intergenic
1025726201 7:64063853-64063875 GAGAAAGGAGAGAAAAGAGTAGG - Intronic
1030065715 7:105657231-105657253 GGCCAAGGGGAGAAAGGAGTTGG + Intronic
1030348164 7:108456052-108456074 CCTGCAGGGGAGAAGGGAGTTGG + Intronic
1031080635 7:117253800-117253822 GCTGGAGGGATGGAAAGAGTGGG - Intergenic
1031315587 7:120254440-120254462 GCGGCAGGGGAGAGAAGAGAGGG - Intergenic
1031979636 7:128116378-128116400 GTTGAAGGGCAGAGAAGAGAAGG + Intergenic
1032062766 7:128738907-128738929 GCTGAAGGGAAAGAAAAAGTTGG + Intergenic
1033755822 7:144397817-144397839 GCAGAAGGGGAGGAAAGATCAGG - Intronic
1034290023 7:149923007-149923029 GCTGAAAGGGAGAAAGGGGGAGG + Intergenic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035747732 8:1974051-1974073 GCGGGAGGGGAGAAAAGGGGAGG + Intronic
1037026175 8:14040837-14040859 ACTGAAGGAGAGAAAAGGGCTGG + Intergenic
1037542889 8:19889289-19889311 GGAGAAGGGGAGGAAAGTGTTGG + Intergenic
1037731781 8:21531902-21531924 GCAGAAGGAGAGAAAAGACAAGG + Intergenic
1038428356 8:27479916-27479938 GCTGAAGGGAAGGAACGAGTGGG - Intergenic
1038773050 8:30501933-30501955 GATGAAGAGGAGAAAAAAGAGGG - Intronic
1039349195 8:36742827-36742849 GCTCAAGGGTAGAAAAGAATTGG - Intergenic
1040040002 8:42906151-42906173 TCTGAAGGGAAAAAAAGAGGGGG - Exonic
1041279232 8:56194859-56194881 GCTGAAGGGAAGAAGTCAGTGGG + Intronic
1041500372 8:58533341-58533363 ATTAAAGGGGAGAGAAGAGTGGG + Intergenic
1042427389 8:68663999-68664021 CCGGAAGGGGAAAAAGGAGTGGG + Intronic
1042612869 8:70617303-70617325 TTTGAAGGGGAGAAGAGAGCAGG + Intronic
1042867916 8:73371807-73371829 GCTGAATGGGAGATAAGGGTAGG - Intergenic
1042949851 8:74189591-74189613 TCTGAAGGGGAAGAAAGAGCTGG + Intergenic
1044262902 8:90148456-90148478 GTTGAAGGTGGGAAAAGAGCAGG + Intergenic
1045005684 8:97914777-97914799 GCTGGAGGCCAGAACAGAGTGGG - Intronic
1045684568 8:104699271-104699293 GCCAAAGGGGAGAAGGGAGTTGG - Intronic
1045731438 8:105246484-105246506 GCTGAAGGTGAGAACTTAGTTGG - Intronic
1047719660 8:127627838-127627860 GCTAATGGGGAGGACAGAGTGGG - Intergenic
1048147267 8:131857592-131857614 GCTGAAGGAGAGAGAAGAGTTGG - Intergenic
1048357796 8:133667667-133667689 GATGAAGGGGAGGGAAGAGGAGG - Intergenic
1048688217 8:136928291-136928313 GCAAAAGTGGAGAAAAAAGTAGG - Intergenic
1049151045 8:141035714-141035736 GCTGAAGGGAAGAACAGTGGAGG - Intergenic
1049690885 8:143958361-143958383 GCTGCAGGGGAGAGAGGAGAAGG - Intronic
1050419494 9:5448613-5448635 GCTGAAGGGTAGAAACAGGTGGG + Intergenic
1051609436 9:18946959-18946981 GAGGACGGGGAGAAAAGATTGGG + Intronic
1052083672 9:24237938-24237960 TCTGAAGGGGAGAAGAGAGAGGG + Intergenic
1052389180 9:27858079-27858101 ACTGGAGAGGAGAGAAGAGTAGG + Intergenic
1052403062 9:28025153-28025175 GTTTAAGGGGAAAAAAGGGTAGG - Intronic
1052607490 9:30723396-30723418 GTGGAAGAGGAGAAAAAAGTGGG + Intergenic
1053574834 9:39348202-39348224 ACTGGAGGGGAGTAAAGTGTAGG + Intergenic
1054096399 9:60906892-60906914 ACTGGAGGGGAGTAAAGTGTAGG + Intergenic
1054513328 9:66009993-66010015 GATGAAAGGAAGAAGAGAGTGGG - Intergenic
1055104381 9:72497310-72497332 GATGAAAGGGAGAAGTGAGTTGG + Intergenic
1055790403 9:79917299-79917321 CCTGAAGGAGAGAATAGTGTTGG + Intergenic
1056112109 9:83406274-83406296 GATGATGGGAAGAAAAGATTGGG - Intronic
1056487355 9:87072533-87072555 TCTGAATGGGAGAAAATAGATGG - Intergenic
1057263870 9:93601453-93601475 ACTGAAGGGAAAAAAAGACTAGG - Intronic
1058136901 9:101317336-101317358 GATGAGGGGGAAAAAAGAATGGG - Intronic
1058935090 9:109762863-109762885 GGTGGAGGGGAGGAAAGAGATGG + Intronic
1059551298 9:115232010-115232032 GAGGAAGGGCAGAAAAGAGGAGG - Intronic
1059651276 9:116318574-116318596 GCTGACGGGGTTAAAAGAGTGGG - Intronic
1059770428 9:117418626-117418648 GCTGAGAGGGAGAAAAGTGGTGG - Intergenic
1061512247 9:131068363-131068385 GCCGAAGGGGAGCAAAGGGATGG + Intronic
1062190428 9:135245249-135245271 GGGGAAGTGGAGAAAAGAGAGGG - Intergenic
1186203371 X:7176455-7176477 GCTGATGGGGTGTAAAGGGTTGG - Intergenic
1186354689 X:8778163-8778185 ACAGAATGGGAGAAAAAAGTGGG + Intergenic
1186494733 X:10003204-10003226 GAAGAAGGGGAGAAATGGGTGGG - Intergenic
1187693366 X:21894175-21894197 GCTGAAGGAGAAATAAGATTTGG + Intergenic
1187783545 X:22857355-22857377 AATAAAGGGGAGAAAAGAGGGGG - Intergenic
1188780429 X:34277426-34277448 ATTGAAGGGGAGAAAAGATAGGG + Intergenic
1190533665 X:51406410-51406432 CCTGAAGGCGAGAAAAGGGAAGG - Intergenic
1190559010 X:51669197-51669219 GCAGATGGGGAAGAAAGAGTAGG + Intergenic
1190565281 X:51724125-51724147 GCAGATGGGGAAGAAAGAGTAGG - Intergenic
1191048101 X:56161218-56161240 GCTGCAAGTGAGAAGAGAGTGGG - Intergenic
1192073222 X:67962669-67962691 CAGAAAGGGGAGAAAAGAGTAGG + Intergenic
1192327742 X:70147499-70147521 GAGGAGAGGGAGAAAAGAGTAGG + Intronic
1192794651 X:74416886-74416908 TATGAAAGGGAGAAAAGGGTGGG + Intergenic
1193175224 X:78384525-78384547 TGGAAAGGGGAGAAAAGAGTGGG + Intergenic
1193280288 X:79641155-79641177 GAGAAAGGGGAGAAAAGAGTGGG - Intergenic
1193911928 X:87316772-87316794 TGTAAAGGGGAGGAAAGAGTAGG - Intergenic
1194257455 X:91652411-91652433 GAAAAAGGGGAGAAAAGAGCAGG - Intergenic
1194546436 X:95240186-95240208 GGAAAAGGGGAGGAAAGAGTGGG + Intergenic
1195224978 X:102783938-102783960 TGGAAAGGGGAGAAAAGAGTGGG - Intergenic
1195588797 X:106600007-106600029 TCTGGAGGGAAGAAAAGAGATGG + Intergenic
1195724296 X:107898382-107898404 GCTTAAGGGGAGACAAGTTTAGG - Intronic
1195871169 X:109487852-109487874 GCTGCAGAGGAGAAAAGAGCAGG + Intergenic
1196035788 X:111143003-111143025 GCTCAAGGAGAGAAAAGATGTGG + Intronic
1196485541 X:116203089-116203111 TGGAAAGGGGAGAAAAGAGTAGG - Intergenic
1196660478 X:118264046-118264068 GCTTGAGGAGAGAGAAGAGTGGG + Intergenic
1196980537 X:121209012-121209034 TGGAAAGGGGAGAAAAGAGTGGG - Intergenic
1197468539 X:126837598-126837620 GCTCAGGGAGAGAAAAGAGAAGG + Intergenic
1198275544 X:135095222-135095244 CCTGTAGGGGAGAGAAGAGGTGG + Intergenic
1198396239 X:136221812-136221834 GATGAAGGGGTGAAAAGACATGG - Intronic
1198739556 X:139826798-139826820 GCTGGAGAAGAGAAACGAGTTGG - Exonic
1198773611 X:140156248-140156270 TGGGAAGGGGAGGAAAGAGTGGG + Intergenic
1200576113 Y:4891357-4891379 GAAAAAGGGGAGAAAAGAGCAGG - Intergenic
1201499884 Y:14630233-14630255 GCTCAAGAGGAGATCAGAGTTGG + Intronic
1201938431 Y:19432690-19432712 ACTCAAGGAGAGAAAATAGTTGG - Intergenic
1202024713 Y:20508953-20508975 GTTGAAGAGGAGAAAACATTGGG - Intergenic