ID: 902039755

View in Genome Browser
Species Human (GRCh38)
Location 1:13484092-13484114
Sequence GCGGAGTGGAGGGGTTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902039755_902039767 22 Left 902039755 1:13484092-13484114 CCTGCTAAACCCCTCCACTCCGC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 902039767 1:13484137-13484159 CCCCGCGCAGGCCACCGTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 81
902039755_902039765 21 Left 902039755 1:13484092-13484114 CCTGCTAAACCCCTCCACTCCGC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 902039765 1:13484136-13484158 GCCCCGCGCAGGCCACCGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 108
902039755_902039763 10 Left 902039755 1:13484092-13484114 CCTGCTAAACCCCTCCACTCCGC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 902039763 1:13484125-13484147 GTTCCTCAAACGCCCCGCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902039755 Original CRISPR GCGGAGTGGAGGGGTTTAGC AGG (reversed) Intronic
900241703 1:1620431-1620453 GCTAAGTGGAGGTGTTTGGCAGG + Intronic
900585413 1:3430251-3430273 CCGGAGTGGAGGGGTCCTGCCGG + Intronic
902039755 1:13484092-13484114 GCGGAGTGGAGGGGTTTAGCAGG - Intronic
902842805 1:19086099-19086121 GTGGAATGGAGGGGATTTGCAGG - Intronic
903325954 1:22568664-22568686 CTGGTGTGGAGGGGCTTAGCGGG - Intronic
904298248 1:29537845-29537867 GCAGAGTGGAAGGGTTTGCCAGG + Intergenic
905247900 1:36627372-36627394 GCTAAATGGAGGGGTTGAGCCGG + Intergenic
906202817 1:43971031-43971053 GCGGGCTGGAGGGCTTAAGCAGG - Exonic
912806224 1:112758985-112759007 GCTGAGGGGAGGGGTTTGTCAGG + Intergenic
914744724 1:150493312-150493334 GGGGGGTGGAGGGGTGGAGCAGG + Intronic
915521315 1:156446043-156446065 GCGGGCTGGAGGGGCTGAGCTGG + Intergenic
918067388 1:181110442-181110464 GTGGAGGGGAGGGGCTGAGCTGG + Intergenic
919663411 1:200269781-200269803 GTGGAGAGGAGTGATTTAGCTGG - Intergenic
922517997 1:226223040-226223062 GGGGAGTGGGGGGGTCTGGCTGG - Intergenic
922875351 1:228936078-228936100 GCAAAATGGAGGCGTTTAGCTGG + Intergenic
924501490 1:244642752-244642774 GCGGAGTTTGGGGGTTTGGCCGG + Intergenic
1069910583 10:71756647-71756669 GCTGACTGCAGGAGTTTAGCTGG + Intronic
1070023656 10:72610803-72610825 GCTGAGTGGAGGAGGTTAGAGGG + Intronic
1076328738 10:129649274-129649296 GTCGAGTGGATGGCTTTAGCTGG + Intronic
1076983946 11:222295-222317 GCGGACTGGAGGTGTTGAGCAGG - Intronic
1079354935 11:19723019-19723041 GCAGACTGGAGGGGTTGAGAGGG + Intronic
1083674608 11:64318477-64318499 GCGGAGGGGAGGGGTCTGGCAGG - Intronic
1084426566 11:69087264-69087286 GGGGGGTGGAGGGGTTGAGGCGG + Intronic
1098789263 12:74800239-74800261 GGGGGGTGGGGGGGTTCAGCAGG - Intergenic
1098898805 12:76091731-76091753 GGGGAGTGGAGGGGTGTATGTGG + Intergenic
1104031176 12:125066405-125066427 GCAGGGTGGAGGGGTGGAGCTGG - Intronic
1104831739 12:131757222-131757244 GTGGAGTAGAGGCGTTCAGCTGG + Intronic
1113727679 13:112617486-112617508 ACTGAGTGGATGGGCTTAGCTGG - Intergenic
1114270321 14:21097166-21097188 GCAGAGTGGAGCGGGTTAGGAGG - Intronic
1117439066 14:55743557-55743579 GGGGAGAGCTGGGGTTTAGCTGG - Intergenic
1117785313 14:59277909-59277931 GGGGAGGGGAGGGTTTTAGATGG - Intronic
1117920218 14:60721438-60721460 GCCGAGGGGAGGGGATTACCCGG + Intronic
1120296415 14:82647474-82647496 GCGGAATGGTGGCGTTTAACAGG + Intergenic
1123191758 14:106578693-106578715 GCGGTGTGGAGGGTTTTAGACGG + Intergenic
1127915267 15:63450234-63450256 GTGGAGTGGTGGGGTTTTGGGGG - Intergenic
1128661851 15:69507093-69507115 GTGGGGTGGAGGGGTTTGGGTGG + Intergenic
1131572479 15:93553066-93553088 GATGGGTGGAAGGGTTTAGCTGG + Intergenic
1132105269 15:99058789-99058811 GCGGAGTGGGGGAGAATAGCGGG - Intergenic
1132688213 16:1171103-1171125 GGGGAGGGGAGGGGCTCAGCAGG - Intronic
1133819916 16:9226889-9226911 GAGGCATGGAGGGGTTGAGCAGG + Intergenic
1134549436 16:15132250-15132272 GAGGAGTGGAGGGGCTCAGCGGG + Intronic
1134710867 16:16326466-16326488 GAGGAGTGGAGGGGCTCAGCGGG - Intergenic
1134948734 16:18342179-18342201 GAGGAGTGGAGGGGCTCAGCGGG + Intergenic
1138891609 16:61150141-61150163 GAGGAGTGGAGGGGATGAGGAGG + Intergenic
1139235211 16:65330967-65330989 GCTGAGTGGAGGAGGTTAGCAGG + Intergenic
1141150518 16:81561634-81561656 GCGGAGTGGAGAGCTTTGGAAGG + Intronic
1142305159 16:89280534-89280556 GCAGAGTGGAGGGGGTCCGCGGG + Exonic
1148459642 17:47831760-47831782 GGGGTGTGGAGGGGCTTTGCTGG - Exonic
1152288950 17:79428046-79428068 GCTGAGTGTAGGGGTTGACCTGG - Intronic
1152510220 17:80781784-80781806 GCGCAGTGCAGGGGCTTTGCTGG - Intronic
1152974551 18:201696-201718 GTGGAGTGGAGTGCTTTGGCAGG + Intronic
1160788503 19:912508-912530 GGGGAGTGGGGGGGTGGAGCAGG + Intronic
1162967497 19:14162915-14162937 GCAGTGTGTAGGGGTTCAGCTGG + Exonic
1164279937 19:23760236-23760258 GTGGAATGGAGGGGGTTAGGGGG - Intergenic
1164703462 19:30302767-30302789 GGGCAGTTGAGGGGTTTATCTGG - Intronic
931614756 2:64144434-64144456 AAGGAGGGGAGGGGTCTAGCCGG + Exonic
932821901 2:74908819-74908841 GCTTAGGGGTGGGGTTTAGCTGG - Intergenic
934615121 2:95765751-95765773 GAGGAGGGGAAGGGTTGAGCTGG + Intergenic
934645782 2:96058736-96058758 GAGGAGGGGAAGGGTTGAGCTGG - Intergenic
934839186 2:97614825-97614847 GAGGAGGGGAAGGGTTGAGCTGG - Intergenic
935462412 2:103353922-103353944 GCCGAGTGGAGGCGCTGAGCCGG - Intergenic
936018852 2:108979698-108979720 GAGGAGAGGAGGGCTTGAGCAGG + Intronic
936331825 2:111553649-111553671 GCGTAGTGAGGGGGCTTAGCGGG - Intergenic
938878237 2:135556212-135556234 GGAGAATGGAGGGGATTAGCAGG + Intronic
939953251 2:148501368-148501390 GTGGATTGGAGGGGAGTAGCAGG + Intronic
941072394 2:160969576-160969598 GGGGTCTGGAGGGGTTTAGAGGG - Intergenic
942051689 2:172146446-172146468 GCAGAGTGGTGGGGCTCAGCTGG + Intergenic
942247812 2:174023885-174023907 GAGGAGTGGAGGGGAGTACCTGG - Intergenic
947796660 2:232897308-232897330 CTGGAGTGGTGGGGTTTTGCAGG + Intronic
948493382 2:238328701-238328723 GCGGTGCGGAGGGTTTTAGCTGG + Exonic
948720804 2:239898942-239898964 GGGGTGTGGAGGGGTGTGGCAGG + Intronic
1173589848 20:44216334-44216356 GCCGCGTGGAGGTGTCTAGCAGG + Intergenic
1174230951 20:49045258-49045280 GAGGAGGGCAGGGGTTTAGGAGG + Intergenic
1176377837 21:6095575-6095597 GCGGAGTGGAGGGGGCAGGCGGG + Intergenic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1179745637 21:43442673-43442695 GCGGAGTGGAGGGGGCAGGCGGG - Intergenic
1180202639 21:46234728-46234750 GAGGAGTGCAGGGGTGTAGCTGG - Intergenic
1180699171 22:17772547-17772569 GCCAAGTGGAGGGGCTGAGCAGG - Intronic
1185288092 22:50011217-50011239 GAGGAGAGGAGGGGTTTGGCGGG - Intronic
1203298532 22_KI270736v1_random:60926-60948 GTGGAGTGGAGGGGATTGGAGGG + Intergenic
950429375 3:12942021-12942043 GCTGAGTGGAGGGGTTTTGCAGG - Intronic
954838847 3:53494354-53494376 GCGGCGCGGAGGGGGTTAACCGG + Intergenic
958942922 3:100334877-100334899 GCGGGGCGGAGGGGCTGAGCCGG - Intronic
959358842 3:105366191-105366213 GGGGAGTGGTGGGGGTGAGCAGG + Intergenic
961339965 3:126211549-126211571 GCAGGCTGGAGGGGCTTAGCAGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
969401112 4:6956277-6956299 GCGGAGTGGAGGGATTGTGCAGG + Intronic
969605024 4:8198072-8198094 GTGCACTGGAGGGTTTTAGCTGG - Intronic
971511703 4:27434431-27434453 GCAGAGTGGAAGGGTGTGGCAGG + Intergenic
976561336 4:86504966-86504988 GCAGAGTGGATGGGCTTTGCTGG - Intronic
979785169 4:124708630-124708652 GGGAAGAGGAGGGGTTTAGAAGG - Intronic
994641248 5:102412151-102412173 GGGGAGGGGAGGGTTGTAGCTGG - Intronic
1003064857 6:2895238-2895260 GCGGAGTGGAGAGGTGGAGGTGG + Intronic
1003855421 6:10268788-10268810 GCAGTGTCGAAGGGTTTAGCAGG - Intergenic
1005401277 6:25436840-25436862 GTGGAGTGGAGAGGGTGAGCTGG + Intronic
1005688733 6:28281521-28281543 GCGGAGTGGCGGAGTCTGGCGGG - Exonic
1006808102 6:36801795-36801817 GCAGGGTGGAGGGGTATAGGGGG + Intronic
1007909666 6:45500969-45500991 GCTGAGTGGAAGGGTTAAGAGGG + Intronic
1011630159 6:89315337-89315359 CCGGAGTGGAGGGGGTGAGTGGG - Intergenic
1017077632 6:150633472-150633494 GCAGAGTGCAGAGCTTTAGCTGG + Intronic
1019411105 7:907135-907157 GCGGAGATGAGGGCTTGAGCTGG - Intronic
1022082225 7:27034105-27034127 GAGCAGTGGAGGGGTATAGCAGG - Intergenic
1031971269 7:128066676-128066698 CGGGAGTGGAGGGGATGAGCTGG + Intronic
1032037353 7:128530842-128530864 GCGGAGCCGAGGGGTTGGGCAGG + Intergenic
1034078293 7:148253326-148253348 GCAGAGTGGAGGCGTTTTGAAGG - Intronic
1037472412 8:19223750-19223772 GTGGAGTGGAGCTGTTTGGCTGG + Intergenic
1037897919 8:22670421-22670443 GTGGAGTAGAGGGCTTGAGCAGG + Intergenic
1039473743 8:37828748-37828770 GAGGAGAGCAGAGGTTTAGCAGG + Intronic
1039836811 8:41263065-41263087 CCTTAGTGGAGGGGTTTACCTGG - Exonic
1040432499 8:47357477-47357499 ATGGAGTGGAGGGGCTTAGATGG + Intronic
1041280945 8:56211076-56211098 GCGGCGGCGAGGCGTTTAGCGGG - Intronic
1044413724 8:91912779-91912801 GGGGTGTGGAGGGCTTTAGAAGG - Intergenic
1045460872 8:102424741-102424763 GCCAAGTGGTGGGGTATAGCAGG - Intergenic
1047132540 8:122037186-122037208 GCAGAGAGGAAGGATTTAGCTGG + Intergenic
1050426820 9:5519690-5519712 GCCAAGTGGAGGTGTTTAGTAGG - Intronic
1050495785 9:6240331-6240353 GTGGGGTGGAGGGGTTCAGCTGG + Intronic
1052854442 9:33398362-33398384 GCCAAGTGGAGGGTTTCAGCAGG + Intronic
1053682447 9:40494523-40494545 GCCAAGTGGAGGGTTTCAGCAGG + Intergenic
1054281267 9:63130406-63130428 GCCAAGTGGAGGGTTTCAGCAGG - Intergenic
1054295546 9:63330023-63330045 GCCAAGTGGAGGGTTTCAGCAGG + Intergenic
1054393566 9:64634527-64634549 GCCAAGTGGAGGGTTTCAGCAGG + Intergenic
1054428215 9:65139741-65139763 GCCAAGTGGAGGGTTTCAGCAGG + Intergenic
1054502165 9:65881803-65881825 GCCAAGTGGAGGGTTTCAGCAGG - Intronic
1057028656 9:91756646-91756668 GAGGAGCTGAGGTGTTTAGCAGG - Intronic
1057186298 9:93059117-93059139 GCGGCGTGGAGAGGCTTGGCCGG - Intronic
1058484858 9:105433631-105433653 GGGCAGTGGAGGGGTGAAGCAGG - Intronic
1192326381 X:70135612-70135634 GAGGAGAGGAGGGCATTAGCCGG + Intronic
1193764279 X:85507156-85507178 GTGGAGTGGAGTGGTGTAGAAGG + Intergenic
1194144568 X:90246674-90246696 GCAGAATGGAGGAGTTTACCTGG + Intergenic
1194411736 X:93566035-93566057 GCGTGATGGTGGGGTTTAGCTGG + Intergenic
1200490325 Y:3815979-3816001 GCAGAATGGAGGAGTTTACCTGG + Intergenic
1201136081 Y:10991130-10991152 GTGGAGTGGAGTGGATTAGAGGG - Intergenic
1201136092 Y:10991185-10991207 GTGGAGTGGAGGGGATCAGAGGG - Intergenic