ID: 902041662

View in Genome Browser
Species Human (GRCh38)
Location 1:13496951-13496973
Sequence GACCCAGAGGGAGGTCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902041658_902041662 -9 Left 902041658 1:13496937-13496959 CCAAGTCATGCTGAGACCCAGAG 0: 1
1: 0
2: 1
3: 18
4: 197
Right 902041662 1:13496951-13496973 GACCCAGAGGGAGGTCATCCTGG 0: 1
1: 0
2: 3
3: 32
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902041662 Original CRISPR GACCCAGAGGGAGGTCATCC TGG Intronic
902041662 1:13496951-13496973 GACCCAGAGGGAGGTCATCCTGG + Intronic
902300590 1:15500005-15500027 GACACTGACGGAGGTCTTCCGGG + Intronic
902368499 1:15991879-15991901 GGCCCAGAGGGAGGTCTGGCTGG + Intergenic
903849277 1:26296545-26296567 GACCCAGAGGAAGGGCCTCATGG + Intronic
903857426 1:26345262-26345284 TACCCAGAGGGAGGTCGTGAAGG - Exonic
905295085 1:36949075-36949097 GACCCAGGGAAAGGCCATCCAGG + Intronic
906110110 1:43317067-43317089 GACCCAGATGGAGGGCACCCTGG - Intronic
906225174 1:44116171-44116193 GCCCCAGGAGGAGGTGATCCTGG + Intergenic
906724722 1:48035909-48035931 GACTCAGTGGGAGGACATGCTGG - Intergenic
906724733 1:48035971-48035993 GACTCAGTGGGAGGACATGCTGG - Intergenic
908587689 1:65590433-65590455 AACCCAGTGGGAGGTAATCATGG + Intronic
910613207 1:89167141-89167163 GACCCAAAGTGAGCTCATCTTGG + Intronic
912727212 1:112068867-112068889 GAGCCACAGGGATGTCATCTGGG + Intergenic
915140304 1:153763841-153763863 GGCCCAGTGTGAGGTCATGCAGG + Exonic
916053038 1:161049286-161049308 CATCCAGAGACAGGTCATCCAGG + Exonic
916418441 1:164614007-164614029 ATACCAGAGGAAGGTCATCCTGG - Intronic
917752723 1:178068281-178068303 CACCCTGAGGGTGGTCATCCTGG + Intergenic
917793157 1:178512812-178512834 GACTCAGAAGGACGTCCTCCAGG - Intergenic
919768408 1:201141851-201141873 GAGCCAGAGGGAGGGCAGCTTGG - Intronic
924516148 1:244768006-244768028 GACCCAGGGGGAGTACAGCCTGG + Intergenic
924719334 1:246607646-246607668 GATCGAGAGAGAGGCCATCCGGG - Intronic
1064637784 10:17386829-17386851 GACCCAGAGAGAGGCCTACCGGG - Intronic
1067850769 10:49752346-49752368 GACCCAGAGGGAGGGCACTGGGG - Intronic
1071457596 10:85862867-85862889 GACCCAGAGGGAGGAAATGGAGG + Intronic
1072191415 10:93079709-93079731 GACCCAGAGAGATGTGACCCAGG - Intergenic
1073053724 10:100685957-100685979 CAGCCAGAGGGGTGTCATCCAGG - Intergenic
1076096945 10:127739662-127739684 GTCCTAGAGGGGGGTCATCAAGG - Exonic
1076406104 10:130213501-130213523 GACCCGGAGAGAGGCCATCCGGG - Intergenic
1077141263 11:1025944-1025966 GACCCAGAGGCACGGCCTCCAGG - Intronic
1077390368 11:2298232-2298254 GTCCCAGAGAGAGGGCAGCCTGG + Intronic
1078013560 11:7592885-7592907 GGCCAGGAGTGAGGTCATCCAGG + Intronic
1078515346 11:12017274-12017296 TAACCAGGGGGAGGTGATCCTGG - Intergenic
1079325356 11:19486456-19486478 GACCCATTGGGAGGTAATCACGG + Intronic
1083063574 11:59899714-59899736 GATCGAGAGAGAGGCCATCCGGG - Intergenic
1083252363 11:61476731-61476753 GACCCAGTGAGAGGACATGCTGG - Intronic
1083429034 11:62604257-62604279 GACCCCCAGGGAGGCCACCCTGG + Intronic
1085205071 11:74726795-74726817 GATCCAGAGAGAAGTCAGCCTGG + Intronic
1085315463 11:75542235-75542257 TACACACAGGGAGGTCAGCCTGG - Intergenic
1085386927 11:76162853-76162875 GACCCAGCAGGAGGTCATCTGGG - Intergenic
1090281941 11:125463864-125463886 AACCCACAGACAGGTCATCCTGG + Intronic
1091880812 12:3976524-3976546 GACAAAGAGGGTGGTGATCCTGG + Intergenic
1092291412 12:7161560-7161582 GCCCCAGAGGCAGCTGATCCAGG - Intergenic
1094161628 12:27396908-27396930 GACCCTCAAGCAGGTCATCCAGG - Intronic
1097000937 12:55875952-55875974 GCCCCAGAGGGATGTCACCAAGG + Intergenic
1101231663 12:102747726-102747748 GACCCAGTGGGAGATCATAGGGG - Intergenic
1101535621 12:105613700-105613722 GACACAGGGTGAGGTCATGCAGG - Intergenic
1103449469 12:121018334-121018356 GACCGAGAGAGACGTCATCCGGG - Intergenic
1104434057 12:128741929-128741951 TACCCAGAGAGAGCTCATCACGG + Intergenic
1110144324 13:72170729-72170751 GATCCAGAAAGAGGGCATCCGGG - Intergenic
1110661364 13:78062037-78062059 GATCGAGAGGGAGGCCATGCGGG + Intergenic
1112746860 13:102536604-102536626 CACCCAGAGGAAGCTCATCTGGG + Intergenic
1113369075 13:109706168-109706190 TACCCTGAGGGAGGTCCTCAAGG - Intergenic
1114486336 14:23064434-23064456 GACACAGAGGGGGGCCAGCCTGG - Exonic
1114495118 14:23126881-23126903 GGCCCGGAGGGAGGTCCTGCAGG + Exonic
1114617465 14:24075892-24075914 GACTCAGAGGGAGGGCACACAGG + Intronic
1118149719 14:63176843-63176865 GCCCTACAGGGTGGTCATCCAGG - Intergenic
1119540083 14:75432254-75432276 TTCCAAGAGAGAGGTCATCCTGG + Exonic
1121310887 14:92934413-92934435 GACCCAGGGTGAGGCCAGCCTGG - Intronic
1122659774 14:103287512-103287534 TACAGAGAGGGAGGGCATCCAGG - Intergenic
1122854326 14:104552915-104552937 TTCCCAGAGGGAGGTTACCCAGG - Intronic
1124462036 15:29900953-29900975 GACTCAGAGGGAGGATATCTAGG + Intronic
1124874572 15:33579905-33579927 GACCCAGTGGGTGTTCATCAGGG + Intronic
1125256596 15:37771109-37771131 GTCCCAGAGGGAAGCCATGCGGG + Intergenic
1127474952 15:59324413-59324435 GACCCAGAAGCAGGTCATTTTGG - Intronic
1128344258 15:66843494-66843516 GCCCCAGAGGAAGGGCTTCCTGG + Intergenic
1128548439 15:68582774-68582796 GACCCAGAGGTGGGTCTTCCAGG + Intronic
1130119090 15:81031351-81031373 GACCTAGTGGGAGGTCATGGGGG + Intronic
1137782956 16:51113563-51113585 GCCCCAGAGGGAGGTCACGGAGG + Intergenic
1144676918 17:17167813-17167835 GGCCCAGATGGATGTCATGCGGG + Intronic
1145978157 17:28996264-28996286 GAGGCAGAGGGAGGTCATCGTGG + Intronic
1152537406 17:80958917-80958939 GACCCAGAGGAAGGGAATACTGG - Intronic
1152866035 17:82723791-82723813 GACCCCGAGAAAGGACATCCAGG - Intronic
1154193900 18:12252309-12252331 GACCCAGCAGGAGATCACCCTGG - Intergenic
1157052352 18:44181283-44181305 GCCCCAGTGGGAGGTCTTCAGGG + Intergenic
1157330416 18:46700022-46700044 CACCCAGATGGGGGTCATGCTGG - Intronic
1158667975 18:59449909-59449931 CACCCAGCAGGAGGTCAGCCGGG - Intronic
1160827706 19:1088476-1088498 CCCCCAGAGGGAGGTCACCTGGG - Exonic
1160900604 19:1426176-1426198 CACCCAGAGGGAGGGGCTCCAGG - Intronic
1161264458 19:3357992-3358014 GGCCCAGAGAGGGGTCAACCTGG - Intergenic
1161436459 19:4266553-4266575 CACCCAGATGGATGTTATCCTGG + Intronic
1161939632 19:7394646-7394668 GACCCTGAGGGAGGACAGCGGGG - Intronic
1164236809 19:23344880-23344902 GATCCAGAGGGAGGCCATCTGGG + Intronic
1164478680 19:28594730-28594752 GAGGCAGAGGCAGGTCATGCAGG - Intergenic
1164837538 19:31366983-31367005 GACCCACAGGGAGGTGACCAGGG + Intergenic
1165093869 19:33400249-33400271 GACCCAGATGGAGGGACTCCAGG + Intronic
1166888302 19:45974115-45974137 AACCCAGAGGGACGTGGTCCAGG - Intergenic
1167471408 19:49678005-49678027 CACCCAGAGGGAGGTCACAGGGG - Intronic
1167524118 19:49973036-49973058 CACCCAGAGTGAGGTCTTGCAGG + Intergenic
1167647041 19:50711524-50711546 GGCCCAGAGGGAGAACAGCCTGG - Intronic
1168194068 19:54760604-54760626 GGCCCAGAGGAAAGTCAGCCTGG - Intronic
1168196113 19:54775337-54775359 GGCCCAGAGGAAAGTCAGCCTGG - Exonic
1168199778 19:54806123-54806145 GACCCAGAGGGAAGTCGGCCTGG - Exonic
1168559684 19:57372518-57372540 GACTCAGAGGGACATGATCCTGG + Intronic
925203100 2:1984920-1984942 GACCCAAAGTGAGCTCCTCCTGG - Intronic
925445122 2:3920694-3920716 AACCCAGAGGGTGGGCATCCAGG - Intergenic
926354015 2:12023242-12023264 GACCCAGTGGGAGGTAATTGAGG + Intergenic
928233838 2:29522921-29522943 CACTCAGAGGGAGGTCTTCTGGG + Intronic
928434845 2:31248336-31248358 GAGGCAGAGGGAGGGCTTCCTGG - Intronic
936463409 2:112727348-112727370 GGCTCAGAGAGAGGTCATCCTGG + Intronic
937103335 2:119288579-119288601 GACCCAGAGAGAGGACATCGAGG + Intergenic
938421604 2:131151579-131151601 CACCCAGCGGCAGCTCATCCTGG - Intronic
938492978 2:131775629-131775651 GGGCCAGAGGGAGGTCTCCCAGG + Intergenic
939964865 2:148600216-148600238 TAGCCGAAGGGAGGTCATCCTGG - Intergenic
940717421 2:157243165-157243187 AACCCAGAGGAAGGTCTTCAGGG + Intergenic
942132974 2:172898723-172898745 GGCCCATAGGGAGGGCAACCAGG - Intronic
942591052 2:177547298-177547320 GTCCCAGAGGTAGGTCAACAAGG + Intergenic
942628610 2:177930963-177930985 GTCCCAAGGGGAGGTGATCCTGG - Intronic
945855466 2:215064311-215064333 GACCCGGAGAGTGGTAATCCAGG - Intronic
947642605 2:231715361-231715383 GCTCCAGTGGGAGGTCATTCGGG - Intergenic
948256512 2:236572606-236572628 GAGGCAGTGGGAGGTCAGCCAGG - Intronic
1168907228 20:1416175-1416197 CACCCAGACTGAGGTCTTCCAGG - Intergenic
1170130179 20:13010772-13010794 GACCCTGAGGGATCTCATCTGGG + Intronic
1171187492 20:23133235-23133257 GCCCCAGAGGGAAGCCATCTGGG - Intergenic
1173418602 20:42880552-42880574 GGCCCAGCAGGAGGGCATCCTGG - Intronic
1173584772 20:44174330-44174352 GAAACAAAGGGAGGCCATCCAGG + Intronic
1173594270 20:44248361-44248383 GGCCCAGAGGCAGGTCCTGCAGG + Intronic
1174167830 20:48597900-48597922 GTCCCAGTGGGAGGTCAGCAGGG - Intergenic
1175814847 20:61878000-61878022 GCCCCAGAGGGAGGACTTCGTGG + Intronic
1177693824 21:24545905-24545927 GACCCAGAGAGAAGTGATTCAGG + Intergenic
1179572810 21:42287858-42287880 GACACAGACGGGGGTCAGCCCGG - Intronic
1179666576 21:42916949-42916971 GATCAAGAGGGAGGTCGCCCTGG - Intergenic
1179929081 21:44555447-44555469 GAGCCAAAGGGAGGGCAGCCTGG + Intronic
1181738983 22:24904911-24904933 GGCCTTTAGGGAGGTCATCCTGG + Intronic
1182022442 22:27092020-27092042 GACTCAGAGAGAGGACATACAGG + Intergenic
1182777747 22:32843462-32843484 GACCCACAGGGAGGTCGGCCTGG - Intronic
1183465481 22:37978196-37978218 CACTCAGAGGGAGGCCAACCTGG - Intronic
1184784430 22:46664854-46664876 GACCCAGGCTGAGGTCATCTGGG - Intronic
950316593 3:12006149-12006171 GACCCAGAGGGAGGGAGTGCTGG + Intronic
950478858 3:13232394-13232416 GCCAGAGAGGGAGGTCATCAGGG - Intergenic
950493884 3:13322304-13322326 CACCCAGAGGGAAGTCATCCAGG - Exonic
953793932 3:45968415-45968437 GAAGCAGTGGGAGGTCACCCAGG - Exonic
954159326 3:48709236-48709258 GCCACAGAGGCAGGGCATCCCGG + Intronic
954385862 3:50243447-50243469 AACCCAGAGTGAGCTCATCTCGG - Intronic
954699406 3:52443517-52443539 GATCCTGAGGTAGGTCCTCCGGG + Intronic
963533615 3:146500906-146500928 GGGCCTGAAGGAGGTCATCCAGG + Intergenic
966878513 3:184336788-184336810 AACCCAGAGGCAGGCCATCAGGG + Intronic
967259008 3:187623593-187623615 GAGCCAGTGTGAGGTCATCTGGG - Intergenic
967838013 3:193980768-193980790 GACCTGGAGGGAGATCATCCAGG + Intergenic
968447151 4:657772-657794 GCAGCAGAGGCAGGTCATCCAGG + Intronic
968447208 4:657966-657988 GCAGCAGAGGCAGGTCATCCAGG + Intronic
968977105 4:3827754-3827776 GTCCCAGAGGAAGGTCAGCCAGG + Intergenic
969100832 4:4766927-4766949 GGCCCAGAGAGAGGAAATCCTGG + Intergenic
969704341 4:8783891-8783913 GAGCCAGACCGAGGTCCTCCAGG + Intergenic
973755242 4:54067542-54067564 GACACAGAGGGAGAGGATCCTGG - Intronic
974489649 4:62548357-62548379 GACCAAGAGAGAGGTCGTCCAGG - Intergenic
975532259 4:75412663-75412685 GAACCAGAGTCAGCTCATCCTGG + Intergenic
982538080 4:156631443-156631465 GGCCCAGAGGGAGGCCACCCAGG + Intergenic
982924374 4:161317751-161317773 GACCCTCAGGCAGGTCATTCAGG + Intergenic
984387271 4:179077213-179077235 GATCCAGAGGGAGGCTGTCCGGG - Intergenic
985944232 5:3164129-3164151 GGCCCCGAGGGGGGTCACCCAGG - Intergenic
986174695 5:5341770-5341792 GTCACAGAGGGAGCTCAGCCAGG - Intergenic
988669057 5:33361433-33361455 GACCCGGTGGGAGGTAATCGTGG - Intergenic
993072260 5:83179776-83179798 GACCTCTAGGGAGGTCAACCTGG + Intronic
995486962 5:112648974-112648996 GGACCAAAGGGATGTCATCCTGG - Intergenic
996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG + Intergenic
997388774 5:133496676-133496698 GACAGTGAGGGAGGTGATCCTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1003598497 6:7496399-7496421 GACCAACAGGGAGGACAGCCTGG + Intergenic
1006613707 6:35311129-35311151 GACCCAGGGATAGGGCATCCTGG + Intronic
1009950933 6:70394784-70394806 GACCGAGAGAGAGGCCGTCCAGG + Intergenic
1011473671 6:87732317-87732339 GACACAGAGGGATGTCATCCAGG + Intergenic
1011813500 6:91160509-91160531 GACCCAGAGAGAGGCCATCAGGG - Intergenic
1012846723 6:104398845-104398867 CACCCAGAGGGATGTAAGCCTGG + Intergenic
1013534063 6:111047290-111047312 CACCCAGAGCAAGGCCATCCTGG - Intergenic
1017015769 6:150098404-150098426 GACCGAGAGAGAGGCCATCCAGG + Intergenic
1017016122 6:150100846-150100868 GACCGAGAGAGAGGCCGTCCGGG + Intergenic
1017137399 6:151160514-151160536 CACCCAAAGGGAGGTAGTCCCGG + Intergenic
1018637762 6:165879421-165879443 GACCCAGAGAGAGGACAGTCAGG - Intronic
1018726745 6:166618507-166618529 GACCTGGAGGGAGGTCAGCGTGG + Intronic
1018758552 6:166870803-166870825 GAGCCAGAGAGAGGTCCTCCGGG + Intronic
1019110861 6:169712475-169712497 GATCCAGAGGGGGCTCATACAGG + Exonic
1019303671 7:322324-322346 GGCGCAGAGGGCGGTGATCCGGG + Intergenic
1019544616 7:1567715-1567737 GGCGCTGAGGGAGGTGATCCGGG - Exonic
1020236487 7:6359755-6359777 AATCCAGAGGTAAGTCATCCAGG - Intergenic
1021241147 7:18202772-18202794 GAACCTGAGAGAGGTCATACAGG + Intronic
1023755238 7:43409981-43410003 CATCCAGAGGGAGGTGATCCAGG + Intronic
1023830600 7:44036917-44036939 GACCCAGAGTGACCTCAGCCAGG + Intergenic
1024236470 7:47402640-47402662 TCCCCAGAGGGAGGTCCTTCTGG + Intronic
1024401667 7:48930741-48930763 GTCCCACTGGGAGGTCTTCCGGG + Intergenic
1028358110 7:89934189-89934211 TACCAGCAGGGAGGTCATCCAGG - Intergenic
1033921496 7:146398454-146398476 GACCCAGTGGGAGGTAATCAGGG - Intronic
1034448832 7:151126726-151126748 CACCCAGAGGCAGGTCACCAAGG + Intronic
1034449653 7:151130463-151130485 GCCCCAGAGGGAGGTGCTCTTGG - Intronic
1034587328 7:152106291-152106313 AACCCAGAGGCAGGTTATCTAGG - Intronic
1035622874 8:1047652-1047674 GACACAGTGGGAGGCCATCTAGG - Intergenic
1035690628 8:1557333-1557355 GACCCTGAGGGAGGTCAGGCAGG - Intronic
1035699482 8:1627131-1627153 GACCAAAAGGGTGGTCATCCTGG + Intronic
1038399599 8:27272923-27272945 GACTCTGAGGGAGGTTATACAGG + Intergenic
1039484652 8:37900951-37900973 GAACCAGAGGGAGGAGAGCCTGG - Intergenic
1039835186 8:41250182-41250204 GACACAGCAGGAGTTCATCCTGG - Intergenic
1041248984 8:55916674-55916696 GAGCCAGAGAGAGGTCAGCCTGG - Intronic
1041859855 8:62500728-62500750 GACCAAGAGGGAGGTTGTCATGG + Intronic
1043506704 8:80909917-80909939 GACCTAGAGGGAGGCCGTCCGGG - Intergenic
1043506946 8:80911569-80911591 GACCAAGAGAGAGGCCGTCCGGG - Intergenic
1043768720 8:84169761-84169783 GATCTAGAGGGAGGCCATCCGGG - Intergenic
1043856743 8:85273630-85273652 GACCGAGAGGGAGGCCATCCGGG + Intronic
1043856799 8:85273982-85274004 GACCGAGACGGAGGCCGTCCGGG - Intronic
1043857403 8:85277825-85277847 GACTGAGAGGGAGGCCGTCCAGG - Intronic
1047020580 8:120771176-120771198 GTCCCAGAGGGAGGTGAACAAGG + Intronic
1047135312 8:122071284-122071306 GACCAAGAGAGAGGCCATCCGGG + Intergenic
1048668548 8:136691272-136691294 GACCGATGGGGAGATCATCCAGG + Intergenic
1049335044 8:142079820-142079842 GACCCAGAGGCAAGTCACCTTGG - Intergenic
1049832811 8:144713141-144713163 CACCGAGTGGGCGGTCATCCGGG + Intergenic
1056709051 9:88975973-88975995 GAGCCCGAGGGAGGTAAACCGGG + Intergenic
1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG + Intronic
1062726335 9:138076132-138076154 AGCCCTGAGGGAGATCATCCTGG + Intronic
1186196909 X:7117913-7117935 GGCTCAAAGGGAGCTCATCCTGG + Intronic
1186400158 X:9250488-9250510 GACCCAGAGGAAGGGCAAGCGGG + Intergenic
1186747903 X:12588342-12588364 TACCCAAAGGGAGGAAATCCTGG - Intronic
1187577838 X:20577250-20577272 GACCAAAAGGGAGATCATCCTGG - Intergenic
1189153739 X:38733869-38733891 GGCCCAGATGGAGGTCTTCATGG + Intergenic
1190743544 X:53306516-53306538 GACCCCAAATGAGGTCATCCAGG + Intronic
1198799492 X:140434258-140434280 GACCCAGCGGGAAGTCAGCCTGG - Intergenic
1199556397 X:149113999-149114021 AGCCCAGAGGGAGCTCATCCGGG + Intergenic
1199935950 X:152573813-152573835 AACCCATAGGGAGGTCCTCAAGG + Intergenic
1200383551 X:155865499-155865521 AGCCCAGAGGGAGCTCATCCCGG - Intergenic
1201794014 Y:17875108-17875130 GATCAAGATGGAGATCATCCTGG - Intergenic
1201807540 Y:18030877-18030899 GATCAAGATGGAGATCATCCTGG + Intergenic
1202355395 Y:24042923-24042945 GATCAAGATGGAGATCATCCTGG - Intergenic
1202515383 Y:25627186-25627208 GATCAAGATGGAGATCATCCTGG + Intergenic