ID: 902043690

View in Genome Browser
Species Human (GRCh38)
Location 1:13510227-13510249
Sequence CCTTGTACCCTCATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902043680_902043690 16 Left 902043680 1:13510188-13510210 CCCCGGAAGAGGCAGAAGGCCTG 0: 1
1: 0
2: 1
3: 35
4: 226
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043677_902043690 20 Left 902043677 1:13510184-13510206 CCTCCCCCGGAAGAGGCAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043685_902043690 -7 Left 902043685 1:13510211-13510233 CCTAGAAAGCCCTGGACCTTGTA 0: 1
1: 0
2: 0
3: 15
4: 127
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043675_902043690 30 Left 902043675 1:13510174-13510196 CCTTCAATTTCCTCCCCCGGAAG 0: 1
1: 0
2: 0
3: 22
4: 129
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043682_902043690 14 Left 902043682 1:13510190-13510212 CCGGAAGAGGCAGAAGGCCTGCC 0: 1
1: 0
2: 5
3: 22
4: 253
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043681_902043690 15 Left 902043681 1:13510189-13510211 CCCGGAAGAGGCAGAAGGCCTGC 0: 1
1: 1
2: 10
3: 44
4: 420
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043684_902043690 -3 Left 902043684 1:13510207-13510229 CCTGCCTAGAAAGCCCTGGACCT 0: 1
1: 0
2: 0
3: 8
4: 180
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
902043679_902043690 17 Left 902043679 1:13510187-13510209 CCCCCGGAAGAGGCAGAAGGCCT 0: 1
1: 0
2: 0
3: 13
4: 151
Right 902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902043690 Original CRISPR CCTTGTACCCTCATGGAGCC TGG Intronic
902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG + Intronic
902436381 1:16400627-16400649 CCTTGGACCCTCAGGCAGCCAGG - Intronic
903796802 1:25935174-25935196 ATATTTACCCTCATGGAGCCTGG - Intergenic
903800374 1:25962862-25962884 CCTAGTAACCTCCTTGAGCCTGG - Intronic
904253410 1:29239831-29239853 CCTCTTTCCCTCATGGTGCCAGG + Intronic
908497547 1:64709878-64709900 TTTTGTACACTCATGGATCCTGG - Intergenic
909303069 1:74038110-74038132 GCTTTTCCCCTGATGGAGCCAGG + Intronic
912466325 1:109877327-109877349 CCTTGTGCCCCCAGGGAGCAGGG + Intergenic
913418150 1:118635334-118635356 CCCAGTACCATCTTGGAGCCTGG - Intergenic
916243701 1:162665381-162665403 CCTTGTTCCCTCATGGCCCTAGG + Intronic
917079052 1:171237645-171237667 GCTTGTCCCCTGCTGGAGCCAGG + Intergenic
917250989 1:173060505-173060527 CCTTGTATCTCCATGGAGCGAGG - Intergenic
920986723 1:210897665-210897687 CCTGGTACCTTCTTGGAGCAGGG - Intronic
922918282 1:229276910-229276932 TCTTGTATCCTCATGAACCCAGG - Intronic
1071430601 10:85603403-85603425 CCTTGAACCCTCATGAAACCAGG - Intronic
1075119600 10:119654848-119654870 CCTTCCTCCCTCATGGAGCAGGG + Intronic
1075968875 10:126636183-126636205 CCTTGTACCCCCTTGGAAGCTGG + Intronic
1076317948 10:129556108-129556130 CCTTGGACCCTGATGGCGCTGGG + Intronic
1077155576 11:1089455-1089477 CGTGCTGCCCTCATGGAGCCAGG - Intergenic
1079028823 11:16969991-16970013 CCTTGTTCCCTCATGAAACTTGG - Intronic
1080324192 11:31050695-31050717 CCTAGTACCAGCCTGGAGCCGGG + Intronic
1085935325 11:81134766-81134788 CCTTGTACCTTCATTGATGCTGG + Intergenic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1089216404 11:116837149-116837171 CCTCCCACCCTCAGGGAGCCAGG - Exonic
1092303819 12:7279356-7279378 CCAAGTACCATCCTGGAGCCTGG - Intergenic
1092920995 12:13231877-13231899 CCTTGCACCCTCATTGATCTGGG + Intergenic
1093097575 12:14989486-14989508 CCTGGGAGCATCATGGAGCCTGG + Intergenic
1093522482 12:20067051-20067073 CCTTTTCCCCTGCTGGAGCCAGG + Intergenic
1094481502 12:30885838-30885860 CCTTGCTGTCTCATGGAGCCAGG + Intergenic
1094802217 12:34049344-34049366 CCTAGTACTAGCATGGAGCCTGG + Intergenic
1096549147 12:52360835-52360857 CCTAGTAGAGTCATGGAGCCAGG - Exonic
1096842856 12:54390109-54390131 CCAGGTACCAGCATGGAGCCAGG + Intronic
1098314895 12:69182685-69182707 GCTTGTCTCCTTATGGAGCCTGG + Intergenic
1101651645 12:106682489-106682511 CCGTGAACCCTCATGGACCATGG - Intronic
1105887427 13:24653649-24653671 CCAGGTTTCCTCATGGAGCCAGG - Intergenic
1106378187 13:29210724-29210746 CCTAGTACCAGCCTGGAGCCTGG - Intronic
1110790513 13:79582030-79582052 GCTTTTACCCTGCTGGAGCCAGG - Intergenic
1111878144 13:93921661-93921683 GCTTGTCGGCTCATGGAGCCTGG + Intronic
1114075682 14:19159966-19159988 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1114085231 14:19233354-19233376 CCTGGTTCCCATATGGAGCCTGG + Intergenic
1114086479 14:19239606-19239628 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1118530664 14:66701942-66701964 ACTTCTCCCCTCCTGGAGCCAGG + Intronic
1119471416 14:74902386-74902408 CCCTGTCCCCTCATGGGTCCCGG + Exonic
1202896796 14_GL000194v1_random:15062-15084 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1125826939 15:42684604-42684626 CCTTGTATCCTCATGGACCCAGG + Exonic
1127291835 15:57578459-57578481 CCTTTCACCCTCATGTAGGCAGG + Intergenic
1129509180 15:76108061-76108083 CCTTGGAGCCTCACGTAGCCAGG - Intronic
1132502419 16:290422-290444 CCTCGGAGCCTCCTGGAGCCAGG + Intronic
1133607556 16:7403087-7403109 AATTGTACCCCCATAGAGCCGGG - Intronic
1135352218 16:21738690-21738712 GCTTGTATGCTCATGGAGCCTGG + Intronic
1135450708 16:22554812-22554834 GCTTGTATGCTCATGGAGCCTGG + Intergenic
1135687670 16:24511190-24511212 CCCAGTAGCCCCATGGAGCCAGG - Intergenic
1143253217 17:5537726-5537748 CCTCCTTCCCTCCTGGAGCCGGG - Intronic
1145810379 17:27760685-27760707 CCTTGCATCCTCATCGGGCCTGG - Exonic
1146932200 17:36785265-36785287 CCTTGCACCGGGATGGAGCCTGG + Intergenic
1148454936 17:47806135-47806157 CCTTGAACACTCATTGATCCTGG + Intergenic
1149395712 17:56240503-56240525 CCTTGTAGCCTCATGTACCTGGG + Intronic
1150227503 17:63531879-63531901 CCTAGGACCCACATGGAGCAGGG - Intronic
1151913945 17:77103817-77103839 CCTCATAACCCCATGGAGCCGGG - Intronic
1152534297 17:80941442-80941464 CCCTGTACTCTCCTGGATCCTGG - Intronic
1153079836 18:1210050-1210072 CCCAGTACCATCCTGGAGCCTGG - Intergenic
1155222761 18:23700264-23700286 CCAAGAACCCTCTTGGAGCCTGG + Intronic
1157473020 18:48004075-48004097 CCTTATAGCCTCATGGTGCCTGG + Intergenic
1160576350 18:79856431-79856453 CCCTGTACCTTCACAGAGCCAGG + Intergenic
1160831355 19:1106159-1106181 CCTTGTGGCCTCCTGGAGACAGG + Intronic
1163103480 19:15110507-15110529 CCTTGTGTCCTCAGGGTGCCAGG + Exonic
1163688346 19:18725032-18725054 CCTTGGACCCGCCTGGAGCTGGG + Intronic
1165388520 19:35525539-35525561 CCAGGACCCCTCATGGAGCCTGG + Intronic
1165854472 19:38871277-38871299 CCTGGTCCCCTCAAGGCGCCAGG + Intronic
1168347704 19:55659020-55659042 CCTGGTCCCCTCATGGTCCCTGG + Intronic
925433204 2:3814887-3814909 GCTTTTCCCCTGATGGAGCCAGG - Intronic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927076238 2:19580770-19580792 GCTTGTCCCCTCACAGAGCCAGG - Intergenic
927142395 2:20139490-20139512 CCTTGTGTCCTCAAGGTGCCTGG + Intergenic
929370905 2:41222921-41222943 ACTTTTACCCTGCTGGAGCCAGG + Intergenic
929375046 2:41275417-41275439 CATTGTACCATTATGGAGCATGG + Intergenic
932846081 2:75137099-75137121 CCTTGTATACTCATGGTGCATGG + Intronic
934046576 2:88177834-88177856 CCTGGTACTCTCATGGGGTCAGG - Intronic
935349617 2:102142414-102142436 TCTACTACCCCCATGGAGCCTGG - Intronic
935638277 2:105267170-105267192 CCATGTACATTCATAGAGCCTGG + Exonic
935638280 2:105267198-105267220 CCATGTACATTCATAGAGCCTGG + Exonic
938490274 2:131757465-131757487 CTGAGTGCCCTCATGGAGCCTGG + Intronic
938986784 2:136584232-136584254 CCTTGTGTCCTCATGGAACTGGG + Intergenic
939417835 2:141924157-141924179 CCTTGTCTTCTCCTGGAGCCTGG - Intronic
946310396 2:218879949-218879971 CCTTGTCTCCTCAGTGAGCCCGG - Intergenic
947129147 2:226903819-226903841 CCTTGTCTCCTTCTGGAGCCTGG - Intronic
947474411 2:230430314-230430336 CCTTGTCCCATCTTAGAGCCTGG - Intronic
948270571 2:236670365-236670387 CCCTGCACCCACAAGGAGCCTGG + Intergenic
1169091782 20:2865330-2865352 CCTGGGACCCACATGCAGCCTGG - Intronic
1171027849 20:21648363-21648385 CCTAGTACCAGCCTGGAGCCTGG + Intergenic
1174242944 20:49152882-49152904 GCTTGTGCCCTCAAGCAGCCTGG - Intronic
1175954903 20:62604208-62604230 CCTTGGAGCCTCCAGGAGCCAGG + Intergenic
1176203995 20:63878258-63878280 CATTGCAGCCTCATGGGGCCAGG - Intronic
1176616483 21:9031058-9031080 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1176707441 21:10126455-10126477 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1176708645 21:10132573-10132595 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1176943115 21:14947829-14947851 CCTTGGGCCAGCATGGAGCCAGG - Intergenic
1177332891 21:19684244-19684266 GCTTTTACCCTGCTGGAGCCAGG - Intergenic
1178334226 21:31730172-31730194 CTTCCTGCCCTCATGGAGCCAGG + Intronic
1180291384 22:10853132-10853154 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180292741 22:10859839-10859861 CCTGGTTCCCATATGGAGCCTGG - Intergenic
1180494189 22:15882554-15882576 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180495547 22:15889261-15889283 CCTGGTTCCCATATGGAGCCTGG - Intergenic
1180940681 22:19658100-19658122 CCATATATCCACATGGAGCCAGG + Intergenic
1181494983 22:23282665-23282687 CCTTGTGCTCTCAGGGAGCCAGG - Intronic
1182623805 22:31631634-31631656 CCCCGTACCCACATGGTGCCAGG + Intronic
949464739 3:4332892-4332914 GCTTGTTGCCTCCTGGAGCCAGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951718563 3:25674285-25674307 CCCTGTACTCTCAGGGACCCAGG - Intergenic
954105295 3:48406578-48406600 CCATGTACCCTGATTCAGCCAGG - Intronic
955374895 3:58386673-58386695 CCTTATACCCTCTTGGAGTAAGG + Intronic
955609150 3:60738940-60738962 CCTTGTCTGCTCCTGGAGCCTGG - Intronic
956894522 3:73646192-73646214 CCCTGTGCCCTCATGGAGTTTGG - Intergenic
964626294 3:158763371-158763393 CTTTTTGCCCTCTTGGAGCCTGG + Intronic
967137126 3:186521938-186521960 CCCTGGGCCCTCATGGAGGCCGG - Intergenic
969428107 4:7137747-7137769 CCTTTTACCCTCACTGAGGCAGG - Intergenic
969592033 4:8127558-8127580 CCTGGCACCCCCATGGAGCGTGG + Intronic
969831450 4:9800925-9800947 CCTAGTACACTCATGCAGTCAGG + Intronic
972249766 4:37287442-37287464 ACTTTTACCCTGCTGGAGCCAGG + Intronic
978032093 4:103947679-103947701 CCTTCTATCCTCATGGAAGCAGG - Intergenic
978140623 4:105313567-105313589 CCTTGTTCCCTCATTAATCCTGG - Intergenic
978199748 4:106012091-106012113 CCCAGTATCCTCCTGGAGCCTGG - Intergenic
978327290 4:107573932-107573954 CCTTGCTCCCTCATGGTCCCAGG + Intergenic
979561712 4:122108623-122108645 CCCTGTACCAGCCTGGAGCCAGG + Intergenic
984604219 4:181766138-181766160 AGTTGTACCTTCTTGGAGCCAGG - Intergenic
985549947 5:528083-528105 GCTGGTGCCCTCAGGGAGCCAGG - Intergenic
987404597 5:17512127-17512149 TCTTGATCCCTCATGTAGCCAGG + Intergenic
992790355 5:80208098-80208120 CTTTATGCCCTCTTGGAGCCAGG - Intronic
995073951 5:107959226-107959248 CCTTGTACCCTGCTAGACCCAGG - Intronic
996155219 5:120090833-120090855 GTTTCTACCTTCATGGAGCCAGG + Intergenic
998929030 5:147159872-147159894 TCTTATACCCTCTTCGAGCCTGG - Intergenic
999850639 5:155534414-155534436 CACTGTACCTTCATTGAGCCTGG - Intergenic
1001035768 5:168295288-168295310 CCTTCTCCTCTCATGGAGTCTGG - Intronic
1001333969 5:170782848-170782870 CCTTGCACCCTGAGGGAGCTGGG - Exonic
1001742484 5:174065359-174065381 CCCTGCACCCTCCTAGAGCCCGG - Intronic
1002326894 5:178415626-178415648 CCCCTTGCCCTCATGGAGCCAGG - Intronic
1004004744 6:11628428-11628450 CCTAGGACCCTCTTGGACCCAGG + Intergenic
1004169972 6:13288272-13288294 CCCTCTACCCTCATGATGCCAGG + Exonic
1004760089 6:18656673-18656695 GCTTTTCCCCTCCTGGAGCCAGG + Intergenic
1005198547 6:23316934-23316956 CATTGTTCCCTCATGGAGGCAGG - Intergenic
1007612964 6:43162114-43162136 CCATGTGCCTTCATGGAGTCTGG + Intergenic
1007670314 6:43547188-43547210 ACTTGTGCCATAATGGAGCCAGG + Intronic
1010438489 6:75863959-75863981 CCTTGTACCCAGAAAGAGCCTGG + Intronic
1011375456 6:86681766-86681788 CCCAGTACCATCCTGGAGCCTGG - Intergenic
1019764106 7:2837019-2837041 TCTTCTACCCTCAAGGAACCAGG + Intronic
1025280924 7:57626091-57626113 TCTGGTATCCACATGGAGCCTGG - Intergenic
1025303806 7:57839416-57839438 TCTGGTATCCACATGGAGCCTGG + Intergenic
1026446407 7:70488336-70488358 CCAGGTGCCCTCATGGAGGCCGG + Intronic
1027429504 7:78095657-78095679 CCTTTTTCCCTCATGGAGAATGG + Intronic
1028885639 7:95929464-95929486 CCTAGTTCCTTCATAGAGCCTGG + Intronic
1028962168 7:96761453-96761475 CCTAGTACCAGCCTGGAGCCTGG - Intergenic
1028995015 7:97090666-97090688 CCTTTTTCCCTCATGGGCCCAGG + Intergenic
1030097629 7:105914948-105914970 CTTTGTACCCTAGTGGTGCCTGG + Intronic
1032935770 7:136729643-136729665 CCTAGTACCAGCTTGGAGCCAGG + Intergenic
1035844286 8:2846445-2846467 CCTTCTCCCCTAAGGGAGCCGGG - Intergenic
1038398295 8:27262967-27262989 CTGGGGACCCTCATGGAGCCTGG + Intergenic
1040835059 8:51722752-51722774 GTTTGTCCCCTCATGGAGCCTGG + Intronic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1043048118 8:75352779-75352801 CCTAGTACCAGCCTGGAGCCTGG + Intergenic
1043071645 8:75643264-75643286 CCCAGTACCATCCTGGAGCCTGG - Intergenic
1044352804 8:91186332-91186354 CCTTGTCTCCTCATTGGGCCTGG - Intronic
1049245961 8:141562653-141562675 CCTGGCACACTGATGGAGCCAGG + Intergenic
1053644635 9:40113193-40113215 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1053645615 9:40118069-40118091 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1053760095 9:41345440-41345462 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1053761347 9:41351658-41351680 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054325658 9:63711073-63711095 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1054326630 9:63715970-63715992 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1054350121 9:64013203-64013225 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054538958 9:66257903-66257925 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1054539941 9:66262776-66262798 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1056783765 9:89573020-89573042 CCCTGTAACCTCAAGGTGCCAGG - Intergenic
1057225693 9:93292011-93292033 CCGGGCACCCTCATGCAGCCAGG - Intronic
1059793808 9:117668791-117668813 CTGTGTACCCTCATAGTGCCAGG + Intergenic
1060804601 9:126566645-126566667 CCTGGTACCCTCATGGAGGGAGG - Intergenic
1061032795 9:128096748-128096770 CCTTCTACCTTCAAGGACCCTGG + Intronic
1061806737 9:133141138-133141160 CCCGGTGCTCTCATGGAGCCAGG - Intronic
1202792189 9_KI270719v1_random:95335-95357 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1202793406 9_KI270719v1_random:101542-101564 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1188661589 X:32766174-32766196 CCATGTAATCTCATGGATCCAGG - Intronic
1192426981 X:71085890-71085912 CCTCATATCCTCATGGAGGCAGG - Intergenic
1196461304 X:115935005-115935027 TCTTGGACCCACATGGGGCCTGG - Intergenic
1196461856 X:115940584-115940606 TCTTCTGTCCTCATGGAGCCAGG - Intergenic
1198073663 X:133174195-133174217 CCTGGCACTCTCAGGGAGCCAGG - Intergenic
1199622261 X:149712141-149712163 CCTTGCCTCCTCATGGAGCCTGG - Exonic
1199628948 X:149762786-149762808 CCTTGCCTCCTCATGGAGCCTGG + Intergenic
1199872667 X:151912948-151912970 CCTTGTCTCCTTATAGAGCCTGG - Intronic
1199894701 X:152118460-152118482 CCTTGCATCCTCACAGAGCCAGG + Intergenic
1199993847 X:153006605-153006627 CCTTGTACCTTCACTCAGCCAGG - Intergenic
1200274350 X:154717783-154717805 CCCTGCCCTCTCATGGAGCCAGG + Intronic
1200798624 Y:7364345-7364367 CCGTGAACCCTCATGCAGCCAGG + Intergenic
1201149860 Y:11089782-11089804 CCTGGTGTCCACATGGAGCCTGG + Intergenic