ID: 902044331

View in Genome Browser
Species Human (GRCh38)
Location 1:13513721-13513743
Sequence GCGTGCGCCCGGGCGTGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902044324_902044331 -9 Left 902044324 1:13513707-13513729 CCCGGGCGGGGAGGGCGTGCGCC 0: 1
1: 0
2: 4
3: 34
4: 260
Right 902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 173
902044321_902044331 2 Left 902044321 1:13513696-13513718 CCAGAGGGCGGCCCGGGCGGGGA 0: 1
1: 0
2: 2
3: 32
4: 270
Right 902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 173
902044314_902044331 16 Left 902044314 1:13513682-13513704 CCGGGCGCGGGGAGCCAGAGGGC 0: 1
1: 0
2: 1
3: 26
4: 264
Right 902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 173
902044325_902044331 -10 Left 902044325 1:13513708-13513730 CCGGGCGGGGAGGGCGTGCGCCC 0: 1
1: 0
2: 3
3: 17
4: 176
Right 902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902044331 Original CRISPR GCGTGCGCCCGGGCGTGCGG GGG Exonic