ID: 902049298

View in Genome Browser
Species Human (GRCh38)
Location 1:13549273-13549295
Sequence CAGTGTCCTCACAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902049288_902049298 27 Left 902049288 1:13549223-13549245 CCAAGATCAAGGTGCAGGCATCC No data
Right 902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG No data
902049294_902049298 -8 Left 902049294 1:13549258-13549280 CCAGAGGGTGGAATGCAGTGTCC No data
Right 902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG No data
902049292_902049298 6 Left 902049292 1:13549244-13549266 CCGGCGACAGCTGTCCAGAGGGT No data
Right 902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902049298 Original CRISPR CAGTGTCCTCACAGGGTAGA GGG Intergenic
No off target data available for this crispr