ID: 902051272

View in Genome Browser
Species Human (GRCh38)
Location 1:13565359-13565381
Sequence TTTATTGGACAGTATAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902051272_902051278 19 Left 902051272 1:13565359-13565381 CCACCTCTATACTGTCCAATAAA No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051272_902051281 26 Left 902051272 1:13565359-13565381 CCACCTCTATACTGTCCAATAAA No data
Right 902051281 1:13565408-13565430 CAAGCAGTTTCTCAGGCTCTTGG 0: 135
1: 91
2: 67
3: 48
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902051272 Original CRISPR TTTATTGGACAGTATAGAGG TGG (reversed) Intergenic
No off target data available for this crispr