ID: 902051278

View in Genome Browser
Species Human (GRCh38)
Location 1:13565401-13565423
Sequence AATCACCCAAGCAGTTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1005
Summary {0: 157, 1: 81, 2: 384, 3: 197, 4: 186}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902051270_902051278 24 Left 902051270 1:13565354-13565376 CCTTCCCACCTCTATACTGTCCA No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051276_902051278 -6 Left 902051276 1:13565384-13565406 CCGGCCTTTATTAGTCAAATCAC 0: 78
1: 371
2: 124
3: 44
4: 165
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051271_902051278 20 Left 902051271 1:13565358-13565380 CCCACCTCTATACTGTCCAATAA No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051277_902051278 -10 Left 902051277 1:13565388-13565410 CCTTTATTAGTCAAATCACCCAA 0: 106
1: 555
2: 156
3: 48
4: 152
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051273_902051278 16 Left 902051273 1:13565362-13565384 CCTCTATACTGTCCAATAAAGAC No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051272_902051278 19 Left 902051272 1:13565359-13565381 CCACCTCTATACTGTCCAATAAA No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186
902051275_902051278 4 Left 902051275 1:13565374-13565396 CCAATAAAGACCGGCCTTTATTA No data
Right 902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG 0: 157
1: 81
2: 384
3: 197
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902051278 Original CRISPR AATCACCCAAGCAGTTTCTC AGG Intergenic
900841186 1:5049831-5049853 AATCACCCAAGCAGTTTCTCAGG + Intergenic
900847804 1:5117551-5117573 AAACAGCCAAGCAGTTTTTCAGG + Intergenic
902051278 1:13565401-13565423 AATCACCCAAGCAGTTTCTCAGG + Intergenic
904996162 1:34633240-34633262 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
905060093 1:35132835-35132857 AATCAGCCAAGCATTTTTTCAGG - Intergenic
905500105 1:38429497-38429519 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
905813276 1:40928749-40928771 ATTCACTCAACCAGTATCTCTGG - Intergenic
906475041 1:46163933-46163955 GGTCAGCCAGGCAGTTTCTCTGG - Intronic
906744193 1:48210264-48210286 AATCAGCCAAGCATTTTTTCAGG - Intergenic
907292952 1:53428718-53428740 AATCAGCCAAGCATTTTTTCAGG + Intergenic
907503246 1:54899151-54899173 AATCAGCCAAGCATTTTTTCAGG - Intergenic
907504819 1:54910452-54910474 AATCACCCAAGCAGTTTCTCAGG - Intergenic
907521584 1:55027023-55027045 AATCAGCCAAGCATTTTTTCAGG + Intergenic
908378731 1:63573906-63573928 AATCACCCAAGCAGTTTCTCAGG - Intronic
908461390 1:64351248-64351270 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
908831329 1:68181505-68181527 AATCTCCCAATCAGTATTTCAGG - Intronic
908852731 1:68390690-68390712 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
909035793 1:70592717-70592739 AATCAGCCAAGCATTTTTTCAGG + Intergenic
909222427 1:72981729-72981751 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
909223337 1:72989098-72989120 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
909550711 1:76896073-76896095 AATCAGCCAAGCAGTTTTTCAGG - Intronic
909729891 1:78877648-78877670 AATCACCCAAGCAGTTTCTCAGG + Intergenic
909776355 1:79489854-79489876 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
909787946 1:79640017-79640039 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
909792656 1:79697624-79697646 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
909910288 1:81249882-81249904 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
909978125 1:82068807-82068829 AATCAGCCAAGCAATTTTTCAGG - Intergenic
910002373 1:82355829-82355851 AATCACTCAAGCAGTTTTTCAGG - Intergenic
911147569 1:94567528-94567550 AATCACCGAAGCAGTTTCTCAGG - Intergenic
911510270 1:98802333-98802355 AATTACCCAAGCAGTTTCTCAGG - Intergenic
911570707 1:99514048-99514070 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
911984264 1:104601138-104601160 AATCACCCAAGCAGTTTCTCAGG + Intergenic
912296790 1:108477407-108477429 AATCAGCCAAGCATTTTTTCAGG + Intergenic
912382071 1:109253185-109253207 AATCGCTCAAGCAGCTTCCCTGG + Exonic
912813911 1:112813875-112813897 AATCACCCAAGCAGTTTCTCAGG + Intergenic
912814912 1:112821347-112821369 AATCACCCAAGCAGTTTCTCAGG - Intergenic
912939290 1:114030840-114030862 GATCACCCAAGCAGTTTCTCAGG + Intergenic
913048059 1:115089968-115089990 AAGCACACAAGCAGCTTCTAGGG + Intergenic
913245592 1:116867460-116867482 AATCACCCAAGCAGTTTCTCAGG + Intergenic
913655655 1:120957195-120957217 AATCACCCGAGCAGTTTCTCAGG - Intergenic
915140488 1:153764873-153764895 ACTCTCCCATGGAGTTTCTCAGG - Intronic
915280979 1:154821977-154821999 AATCACCCAAGTAGCTGCTAAGG + Intronic
915895945 1:159810965-159810987 GATCACCCCAGCAGGTTCCCAGG + Intronic
916329197 1:163595542-163595564 AATCACCCAAGCAGTTTCTCAGG + Intergenic
916942042 1:169686596-169686618 AAGCACGCAAGCAGTTTCTCAGG + Intronic
916981496 1:170143024-170143046 AATCACACCAGAAGTTTCTTTGG + Intergenic
917750068 1:178044944-178044966 AAATACCCAAGCAATTTCTCAGG + Intergenic
918347440 1:183618070-183618092 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
918567342 1:185949581-185949603 AATCAGCCAAGCAGTTTTTCAGG - Intronic
918714077 1:187766797-187766819 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
918894187 1:190318498-190318520 AATCTCCCAAACTGCTTCTCAGG + Intronic
919476794 1:198039712-198039734 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
920426912 1:205885824-205885846 AATCACCCAAGCAGTTTCTCAGG - Intergenic
920829644 1:209452739-209452761 AATCAGCCAAGCATATTTTCAGG + Intergenic
920901190 1:210112002-210112024 AATCTCCCAAGCAGTTTCTCAGG - Intronic
920908461 1:210192469-210192491 AATCACCCAAGCAGTTTCTCAGG + Intergenic
921205543 1:212845527-212845549 AATCACCTGAGCAATTTCTCAGG + Intronic
921212655 1:212913317-212913339 AATCAGCCAAGCAGTTTTCCAGG + Intergenic
921459475 1:215411423-215411445 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
921509600 1:216012586-216012608 AATCAGCCAAGCAGTTTTTCAGG + Intronic
921520386 1:216149365-216149387 AATCACCAAAGCAGTTTCTCAGG + Intronic
921732653 1:218595087-218595109 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
922048727 1:221970365-221970387 AATCAGCCAAGCATTTTCTCAGG + Intergenic
922049213 1:221974388-221974410 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
922363143 1:224841178-224841200 AATCACTCAAGCAGTTTCTCAGG - Intergenic
922845007 1:228677826-228677848 AATCACCCAAGCAGTTTCTCAGG - Intergenic
922877400 1:228950672-228950694 AATCAGCCAAGCATTTTTTCAGG + Intergenic
922906720 1:229178857-229178879 AATCAGCCAAGCAGTATTTCAGG + Intergenic
923075548 1:230605822-230605844 AATCACCCAAGCAGTTTCTCAGG + Intergenic
923213790 1:231830934-231830956 AATCAGCCAAGCAGTTTTTCAGG - Intronic
923245078 1:232122608-232122630 AATCAGCCAAGCAGGTTTTCAGG + Intergenic
923257012 1:232230914-232230936 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
923408307 1:233684718-233684740 AATCGGCCAAGCAGTTTTTCAGG - Intergenic
923770423 1:236933549-236933571 AATCAGCCAAGCATTTTTTCAGG - Intergenic
923963113 1:239105788-239105810 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
924181020 1:241438609-241438631 AATCAGCCCAGCAGTTTTTCAGG + Intergenic
924895786 1:248336965-248336987 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1063363518 10:5475744-5475766 AATGAGCCAAGCAGTTTTTCAGG + Intergenic
1063509271 10:6630881-6630903 AATGAGCCAAGCAGTTTTTCAGG - Intergenic
1063527362 10:6798379-6798401 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1064331089 10:14394888-14394910 AATCACCCCATCAGCTCCTCCGG + Intronic
1064886672 10:20120453-20120475 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1065438047 10:25721645-25721667 AATCAGCCAAGCATTTTTACGGG + Intergenic
1065442803 10:25770036-25770058 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1066436731 10:35402848-35402870 TATTACCCAAGCAGTTTCTCAGG - Intronic
1066807222 10:39270736-39270758 ACATACCAAAGCAGTTTCTCAGG + Intergenic
1068058024 10:52035049-52035071 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1068179295 10:53500121-53500143 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1068231298 10:54171182-54171204 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1068471776 10:57474259-57474281 AATCACTCAAACTGATTCTCTGG + Intergenic
1068592014 10:58862299-58862321 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1068992702 10:63166108-63166130 AATCACTGGAGCAGTTCCTCTGG - Intergenic
1069147476 10:64912978-64913000 TAATACCCAAGCAGTTTCACTGG + Intergenic
1069559434 10:69419227-69419249 AAACACACCAGCTGTTTCTCAGG + Intergenic
1070475163 10:76822394-76822416 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1070706456 10:78642560-78642582 AATTACCCAAGCTGTTGCTAAGG - Intergenic
1070893864 10:79964991-79965013 AATCACCCAAACAGTTTCTCAGG + Intronic
1071370380 10:84945259-84945281 AATGACCCAAGCATACTCTCTGG + Intergenic
1071822146 10:89289649-89289671 AATCACCCAAGCAGTTTCTCAGG + Intronic
1071897418 10:90082321-90082343 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1071916529 10:90299418-90299440 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1071961455 10:90811934-90811956 AATCAGCCAAGTAGTTTTTCAGG + Intronic
1072010941 10:91302493-91302515 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1072031457 10:91526204-91526226 AATAACCCAGGCAGTCTCCCTGG - Intergenic
1073130516 10:101185953-101185975 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1073436680 10:103521203-103521225 AATCACCCAAGCAGTTTCTCGGG - Intronic
1073683902 10:105732173-105732195 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1074019398 10:109566990-109567012 AATCACCCAAGCAGTTTGTCAGG + Intergenic
1074741130 10:116485238-116485260 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1075014341 10:118899200-118899222 AATCAGCCAAGCAGTTTCTCAGG + Intergenic
1075249025 10:120849261-120849283 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1075777816 10:124999403-124999425 AATCACCAAGGCAGCTTCTTCGG + Intronic
1077588417 11:3472572-3472594 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
1077612521 11:3652360-3652382 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1077678737 11:4220558-4220580 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1077688174 11:4317198-4317220 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1077766062 11:5161559-5161581 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1077850478 11:6071125-6071147 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1077883720 11:6370427-6370449 AAGCACCCAAGCAGTTTCTCAGG + Intergenic
1078045819 11:7913450-7913472 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1078720057 11:13875979-13876001 AACCTCCCAAGCTGTGTCTCTGG + Intergenic
1079672242 11:23185223-23185245 AATCAGCCAAACAGTTTTTCAGG - Intergenic
1079726762 11:23888474-23888496 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1079835597 11:25328947-25328969 AATTGCCCAAGCAGTTTCTCAGG - Intergenic
1079847246 11:25487742-25487764 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1080027586 11:27630367-27630389 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1080203863 11:29706654-29706676 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1081160167 11:39739759-39739781 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1081730392 11:45368052-45368074 AGGCACCCAAGTAGTGTCTCAGG + Intergenic
1082633026 11:55562800-55562822 AATTACCCAAGCCATCTCTCAGG + Intergenic
1083105862 11:60358084-60358106 AAACACCAAAGCAGTAACTCAGG + Intronic
1084232624 11:67764082-67764104 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1084244118 11:67844200-67844222 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
1084354634 11:68629558-68629580 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1084355875 11:68638120-68638142 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1084585436 11:70058853-70058875 AATCACCCAAGCCGTCTCTCAGG - Intergenic
1084612953 11:70215519-70215541 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1084828569 11:71750363-71750385 AGTCAGCCAAGCATTTTTTCAGG + Intergenic
1085934601 11:81126207-81126229 AATCAGCCATGCATTTTTTCAGG + Intergenic
1085988428 11:81811396-81811418 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1086134379 11:83431895-83431917 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1086135848 11:83443386-83443408 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1086550632 11:88048358-88048380 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1086658467 11:89385953-89385975 AATCACCCAAGCAGTTTCTCAGG + Intronic
1087099414 11:94350140-94350162 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1087099992 11:94354266-94354288 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1087128138 11:94646030-94646052 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1087167652 11:95021125-95021147 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1087197311 11:95314490-95314512 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1087315000 11:96592350-96592372 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1087839183 11:102905160-102905182 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1087915088 11:103800673-103800695 AATGACACAGGCAGTTGCTCTGG - Intergenic
1088555308 11:111054826-111054848 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1088940008 11:114444060-114444082 AAACAAGCAAGCAGTTTCCCAGG - Intronic
1089349322 11:117813068-117813090 AATCAGCCAAGCATTTTTTCAGG + Intronic
1089470731 11:118718295-118718317 AATCAGCCAAGCAGGTTTTCAGG - Intergenic
1089953767 11:122552310-122552332 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1089976988 11:122741539-122741561 GATCACTCACGCAGTTCCTCTGG - Intronic
1089987999 11:122831539-122831561 AATCAGCCAAGCAGGTTTTCAGG + Intergenic
1090107215 11:123866564-123866586 AATCAGCCAAGCAGGTTTTCAGG - Intergenic
1090526445 11:127543812-127543834 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1090552848 11:127841747-127841769 CATCACCCAAGCAGGTGCACTGG + Intergenic
1090731397 11:129575760-129575782 AGTCATCCAAGAAGTTCCTCTGG + Intergenic
1090850265 11:130565652-130565674 AATCAGCCAAGCAGTTTCTCAGG - Intergenic
1090871640 11:130754800-130754822 AATCAGCCAAGCAGGTTTTCAGG - Intergenic
1090926608 11:131255780-131255802 AATCAACCAAGCATTTTTTTAGG - Intergenic
1091184032 11:133631424-133631446 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1091787891 12:3253947-3253969 AATCACCTGAGCATTTTCACAGG - Intronic
1091886760 12:4022364-4022386 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1092414680 12:8281337-8281359 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
1092474809 12:8809346-8809368 AATCAGCCAAGCCTTTTTTCAGG + Intergenic
1092626423 12:10334212-10334234 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1092723414 12:11463468-11463490 AATGAGCCAAGCAGTTTTTCAGG - Intronic
1092739002 12:11610994-11611016 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1092790035 12:12062810-12062832 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1092924457 12:13260875-13260897 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1093070923 12:14706766-14706788 TATCAGCCAAGCAGTTTTTCAGG - Intergenic
1093267724 12:17023166-17023188 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1093302973 12:17477408-17477430 AATCACCCAAGCCATCTCTCAGG + Intergenic
1093321659 12:17721493-17721515 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1093358891 12:18200382-18200404 AATCACCCAAGCAGTTTCTCAGG + Intronic
1093579134 12:20767791-20767813 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1093812474 12:23507112-23507134 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1093851760 12:24047976-24047998 AATCAGCCAAGAAGGTTCTCAGG + Intergenic
1094290990 12:28850044-28850066 AAGCACCCAAGGAGATTCTTGGG - Intergenic
1094315687 12:29136059-29136081 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1094401105 12:30061170-30061192 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1094826185 12:34270915-34270937 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1095638032 12:44454767-44454789 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1095778620 12:46035280-46035302 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1095806331 12:46324462-46324484 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1096906856 12:54944133-54944155 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1097398905 12:59106266-59106288 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1097416734 12:59324511-59324533 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1097541768 12:60952502-60952524 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1097592764 12:61591843-61591865 AATTACCCAAGCAGTTTCTCAGG + Intergenic
1098173342 12:67768083-67768105 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1098629379 12:72707775-72707797 AATCAGCCAAGCCATTTTTCAGG + Intergenic
1098653467 12:73003091-73003113 AATCACCCAACCAGTTTTTTAGG - Intergenic
1098920347 12:76296787-76296809 TATCACCCAAGCAGTTTCTCAGG + Intergenic
1099189038 12:79544289-79544311 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1099291772 12:80784369-80784391 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1099369054 12:81807711-81807733 AATCATACAAGCAGTGTCTGAGG - Intergenic
1099762949 12:86943440-86943462 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1099835740 12:87908486-87908508 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1100277882 12:93088258-93088280 AAACACTCAAGAAGTTCCTCTGG - Intergenic
1100561681 12:95753586-95753608 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1100940730 12:99720458-99720480 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1101278075 12:103223970-103223992 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1102116339 12:110406023-110406045 AATCACCGAAGCAGTTTCTCAGG - Intergenic
1102604952 12:114061180-114061202 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1104464055 12:128976313-128976335 ACCCACCCAATCAGTATCTCGGG + Intronic
1107219931 13:37970259-37970281 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1107682900 13:42869311-42869333 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1107702330 13:43060732-43060754 AATCACCCAAGCTGTTTCTCAGG - Intronic
1108281625 13:48867652-48867674 AATCACCCAAGAAGTTTGTCAGG - Intergenic
1108513234 13:51173688-51173710 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1108702876 13:52958669-52958691 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1108803516 13:54128666-54128688 AATCAGCCAAGTATTTTTTCAGG - Intergenic
1108913098 13:55579529-55579551 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1108919226 13:55656249-55656271 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1108947785 13:56044940-56044962 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1108952626 13:56113705-56113727 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1109343949 13:61093163-61093185 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1109353327 13:61210010-61210032 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1109499626 13:63217535-63217557 AATCAGCCAAGCAGTTTTCCAGG + Intergenic
1109709345 13:66142617-66142639 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1109716413 13:66227670-66227692 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1110650130 13:77934407-77934429 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1110765806 13:79278565-79278587 AATCAGCCAAGCAGTTTTTTAGG + Intergenic
1110845734 13:80188661-80188683 AATCAGCCAAGCGTTTTTTCAGG + Intergenic
1110978867 13:81871161-81871183 AATCAGCCAAGCGTTTTTTCAGG + Intergenic
1111125715 13:83909569-83909591 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1111302368 13:86362834-86362856 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1111361781 13:87187707-87187729 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1111458522 13:88514116-88514138 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1111630753 13:90843846-90843868 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1111631382 13:90849873-90849895 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1112237186 13:97646933-97646955 AATCACCCAAGCATTTTTTCAGG + Intergenic
1112249097 13:97762536-97762558 AATTACCCCACCAGTTTTTCTGG - Intergenic
1112283538 13:98083787-98083809 ACTGAGCCAAGAAGTTTCTCAGG + Intergenic
1112334424 13:98502149-98502171 GATCATCCAAGCACTTACTCAGG + Intronic
1112888955 13:104208847-104208869 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1113637684 13:111931349-111931371 CATCACCCAAGCAGTATACCCGG + Intergenic
1114234958 14:20815511-20815533 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1115905130 14:38195203-38195225 AATGAGCCAAGCAGTTTTTCAGG + Intergenic
1116180024 14:41520566-41520588 AATCAGGCAAGCAGTTTTTCAGG + Intergenic
1116490202 14:45496132-45496154 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1116534453 14:46013709-46013731 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1116573777 14:46548337-46548359 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1116613753 14:47108003-47108025 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1116702036 14:48256454-48256476 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1116702970 14:48263653-48263675 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1117801499 14:59448505-59448527 AATCACCCAAGCAGTTTTTCAGG + Intronic
1117957554 14:61134494-61134516 AATCAGCGAAGCAGTTTTTCAGG - Intergenic
1118936880 14:70296707-70296729 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1119022739 14:71128727-71128749 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
1119317523 14:73707915-73707937 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
1119559869 14:75581498-75581520 AATCACCCAAGCAGTTTCTCAGG - Intronic
1120210838 14:81632321-81632343 AATTACACAATCAGCTTCTCTGG - Intergenic
1120251032 14:82062162-82062184 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1120437724 14:84501501-84501523 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1120539158 14:85733691-85733713 AATCAGCCAAGCATTTCTTCAGG - Intergenic
1120618564 14:86735781-86735803 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1120659578 14:87235947-87235969 AATCAGTCAAGCAGTTTTTCAGG - Intergenic
1120968650 14:90189805-90189827 AATCCTCCAAGCAATTTCTGTGG - Intergenic
1121192853 14:92045293-92045315 AATCACCCAAGCAGTTTCTCAGG - Exonic
1121389566 14:93562644-93562666 AATCACCCAAGCAGTTTCTCAGG - Intronic
1121704016 14:95977589-95977611 AATCACCCAAGCATTTTTTCAGG + Intergenic
1121980209 14:98448010-98448032 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1122041318 14:98989621-98989643 AATCACCCAAGCAGTTCCTCAGG + Intergenic
1122380936 14:101306527-101306549 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1122508076 14:102244812-102244834 AATCACCCAAGCAGTTTCTCAGG + Intronic
1123882148 15:24686609-24686631 AATCACCCAACCAGCTTTTTAGG - Intergenic
1125046013 15:35242574-35242596 AATCAGCCAAGCATTTTTTCAGG + Intronic
1125131194 15:36286924-36286946 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1125212893 15:37237477-37237499 AATCACCCAAGCAGTTTATCAGG - Intergenic
1125849479 15:42889441-42889463 AATCACCCAAGCAGTTTCTCAGG + Intronic
1126564100 15:50076583-50076605 AAGCAGCCAAGTAGTTTCTATGG + Intronic
1126844190 15:52743911-52743933 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1126912091 15:53428128-53428150 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1127796477 15:62442554-62442576 CAGCAACCAAGCAGTTTCCCAGG - Intronic
1129259812 15:74358805-74358827 AATCACTCAAGCAGTTTCTCAGG + Intronic
1130304945 15:82707144-82707166 AATCACCCAAGCAGTTTCTCAGG + Intronic
1130781435 15:87044260-87044282 AAGCACCCAAGCAATTGCTCAGG + Intergenic
1130855427 15:87835691-87835713 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1130945591 15:88548574-88548596 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1131165135 15:90136653-90136675 AAATCACCAAGCAGTTTCTCAGG + Intergenic
1131270508 15:90944734-90944756 GATCAGCTAAGCAGATTCTCCGG + Intronic
1131448097 15:92516140-92516162 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1131684511 15:94755193-94755215 AATCAGCTAAGCAGTTTTTCAGG + Intergenic
1131685078 15:94759105-94759127 AATAAGCCAAGCATTTTTTCAGG + Intergenic
1131882187 15:96873105-96873127 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1132089965 15:98940218-98940240 AATCTCCCCTGCAGTTTCTCAGG - Intronic
1132263382 15:100444928-100444950 AATCAGCCAAGCGTTTTTTCAGG + Intronic
1132340756 15:101076968-101076990 AATCAGCCAAGCGTTTTTTCAGG + Intronic
1133651720 16:7819163-7819185 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1133765399 16:8834315-8834337 AATCACCCAAGCAGTTTCTCAGG - Intronic
1133766405 16:8841212-8841234 AATCACCCAAGCAGTTTCTCAGG - Intronic
1133869157 16:9671817-9671839 AATCAGCCAAGCAGCTTTTCAGG - Intronic
1133939154 16:10293991-10294013 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1134341859 16:13353861-13353883 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1136588098 16:31200916-31200938 AACCACCAAAGCAGATTTTCAGG - Intergenic
1136634201 16:31508843-31508865 AAAGACCCAAGCAGCTTCACAGG - Intronic
1136678316 16:31936151-31936173 TATCACCCAAGCTTTTTCCCAGG - Intergenic
1137363865 16:47843757-47843779 ACTCACCCAAGCAGTTTCTCAGG + Intergenic
1137896248 16:52216144-52216166 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1138027476 16:53533521-53533543 AATCACCTAATCTGTCTCTCAGG - Intergenic
1138758678 16:59518237-59518259 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1138805271 16:60083254-60083276 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1139038913 16:62980431-62980453 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1139225592 16:65231113-65231135 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1139230260 16:65276545-65276567 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1139942729 16:70617766-70617788 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1139943393 16:70622084-70622106 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1140239803 16:73190785-73190807 ACTCACCGAACCAGTGTCTCAGG + Intergenic
1141733315 16:85836461-85836483 AAGCAGCCCAGCAGTTGCTCGGG + Intergenic
1141864878 16:86743314-86743336 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1143421332 17:6795122-6795144 AATCCCACATGCAATTTCTCAGG - Intronic
1144104904 17:11975690-11975712 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1144843479 17:18203330-18203352 ATTCACCCCAGCAGCTTCTCTGG + Intronic
1146124122 17:30218664-30218686 AATTACTCAAGCAGTCTCCCAGG + Intronic
1146598226 17:34187705-34187727 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1146717398 17:35098139-35098161 TGTCACCCAAGGAGTTTCTGTGG - Intronic
1148402287 17:47375690-47375712 AATCACTGAATAAGTTTCTCAGG - Intronic
1149220938 17:54414703-54414725 CATCACCCAAGCAGTTTCTCAGG + Intergenic
1149311559 17:55399156-55399178 ATTCACCCCAGTAGTTTCCCTGG - Intronic
1149320098 17:55473520-55473542 AATCACCTAAGCAGTTTTTCAGG + Intergenic
1151622814 17:75256989-75257011 AATCAGCCAAGCAGTTTCTCAGG + Intronic
1151839427 17:76607245-76607267 AATCAGCCAAGCAGTTTCTCAGG - Intergenic
1151931285 17:77233474-77233496 AACCAGCCAAGCAGATTCCCTGG + Intergenic
1152454390 17:80404941-80404963 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1155174224 18:23288779-23288801 AATCAGCCAAGCAGGTTTTCAGG + Intronic
1155696673 18:28694307-28694329 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1155892360 18:31285458-31285480 AATCACCCAAACAATTTCTCAGG - Intergenic
1155941949 18:31808782-31808804 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1156251573 18:35357401-35357423 AATCAGCGAAGCATTTTTTCAGG - Intergenic
1156302682 18:35849113-35849135 AATCACCCAAACAGTTTCTCAGG + Intergenic
1156520690 18:37720182-37720204 AATCACTGAAGCAGCTACTCTGG + Intergenic
1156916226 18:42466598-42466620 AATCACCCAAGCAGTTTCTGAGG + Intergenic
1156923714 18:42553646-42553668 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1156938849 18:42741075-42741097 AATCAGCCATGCAGTTTTTCAGG + Intergenic
1156958555 18:42995535-42995557 AATCAGTCAAGCATTTTTTCAGG + Intronic
1157906067 18:51571323-51571345 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1158336694 18:56420020-56420042 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1158394324 18:57067915-57067937 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1158576406 18:58642440-58642462 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1159018286 18:63120697-63120719 AATTACCCAAGCATTTTATCAGG - Intergenic
1159136048 18:64338009-64338031 ACCCACCCATTCAGTTTCTCTGG + Intergenic
1159164814 18:64686055-64686077 AATCCGCTAAGCAGTTTTTCAGG + Intergenic
1159835367 18:73329064-73329086 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1159929563 18:74296958-74296980 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1160136716 18:76278004-76278026 GATCACCCAAGCCATTTCACAGG - Intergenic
1161827159 19:6575729-6575751 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1162262687 19:9545592-9545614 AGTCACTCAAGCAGTCTCTCAGG + Intergenic
1162287134 19:9747167-9747189 GATCACTCAAGCAGTCTCCCAGG + Intergenic
1163487617 19:17597851-17597873 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1163899753 19:20090975-20090997 AATCACCCAAGCAGTTTCTCAGG - Intronic
1163907497 19:20159960-20159982 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1163944055 19:20519782-20519804 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1164011904 19:21210844-21210866 AAGCTCTCCAGCAGTTTCTCTGG - Intergenic
1164153374 19:22573222-22573244 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1164202078 19:23027366-23027388 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1164220479 19:23188675-23188697 AATCACCCCAGTAGTTTCTCAGG - Intergenic
1165510001 19:36260777-36260799 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1165835689 19:38754075-38754097 AATCAGCCAAGCATTTTTTCAGG + Intronic
1166498611 19:43324795-43324817 AATCAGCCAATTAGTTTTTCAGG - Intergenic
1166905334 19:46104416-46104438 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1166926757 19:46274408-46274430 AATCACCCAAGGAGTTTCTCAGG - Intergenic
1167046284 19:47051111-47051133 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1167099794 19:47397460-47397482 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1167902473 19:52632197-52632219 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1167917713 19:52755596-52755618 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1168051963 19:53836025-53836047 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1168211710 19:54895560-54895582 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1168227657 19:55008042-55008064 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1168248664 19:55128001-55128023 AATCACCCAAGCAGTCTCTCAGG + Intergenic
925544874 2:5005406-5005428 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
925828505 2:7873986-7874008 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
926345133 2:11937985-11938007 AAACAGCGAAGCAGGTTCTCAGG - Intergenic
926408085 2:12574191-12574213 AATCAGCCAAGCATTTTATCAGG + Intergenic
926413908 2:12630925-12630947 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
926463731 2:13165057-13165079 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
926815224 2:16793225-16793247 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
927134544 2:20087179-20087201 AATCACCCAAGCAGTTTCTCAGG + Intergenic
928779383 2:34802254-34802276 AATCAGCCAAGCATTTTTTTTGG - Intergenic
928827305 2:35438173-35438195 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
928857509 2:35817512-35817534 AATCAGCCAAGCATTTTTTCAGG + Intergenic
928928894 2:36603460-36603482 AATTAGCCAAGCAGTTTTTCAGG + Intronic
929004501 2:37382250-37382272 AATCACCCAAGCAGTTTCTCAGG - Intergenic
929076346 2:38082052-38082074 AATCAGCCAAGCAGTTTTTCAGG - Intronic
929792742 2:45035722-45035744 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
930098586 2:47585982-47586004 AATCACCCAAGCAGTTTCTCAGG - Intergenic
930486988 2:52023180-52023202 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
930706288 2:54508130-54508152 AATCACCCAAGCAGTTTCTCAGG - Intronic
930955416 2:57197376-57197398 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
931026067 2:58114708-58114730 AATCAGCCAAGCAGTTTTTCAGG - Intronic
931042942 2:58318122-58318144 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
931608618 2:64076468-64076490 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
931626011 2:64256305-64256327 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
931850740 2:66248350-66248372 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
931874871 2:66501295-66501317 AATCCCCCAATCTTTTTCTCAGG - Intronic
931948607 2:67336240-67336262 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
932159050 2:69444262-69444284 AATCACCCAAGCAGTTTTTCAGG - Intergenic
932296186 2:70625141-70625163 AATCAGCCAAGCATTTTTTCAGG + Intronic
932366900 2:71159057-71159079 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
932853885 2:75215028-75215050 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
932973592 2:76574925-76574947 AATCAGCCAAGCAGTTTTTCGGG - Intergenic
933013414 2:77092802-77092824 AATCAGCCAAGCAGTTTTTCAGG + Intronic
933079593 2:77969531-77969553 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
933138345 2:78762846-78762868 AATCACCCAAGCAGTTTCTCAGG + Intergenic
933164043 2:79055800-79055822 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
933179392 2:79212584-79212606 AATCAGCCAAGCAGTTTTTCGGG - Intronic
933552080 2:83790195-83790217 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
935732619 2:106076740-106076762 AATCACAAATGCAGGTTCTCAGG - Intronic
936540469 2:113346248-113346270 AATCCTCAAAGCAGCTTCTCGGG - Intergenic
936793913 2:116185015-116185037 AATCAGCCAAGCATTTTTTCAGG - Intergenic
936883647 2:117283160-117283182 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
939307800 2:140431120-140431142 AATCAGCAAAGCATTTTTTCAGG + Intronic
939460359 2:142490638-142490660 AATCACCCAAGCAGTTTCTCAGG - Intergenic
940107716 2:150117241-150117263 AATCAGCCAAGCATTTTTTCAGG + Intergenic
940183361 2:150958027-150958049 AATCACCCAAGCAGTTTCTCAGG + Intergenic
940376629 2:152965562-152965584 AATAACTCAAGCGGTTTCTAAGG - Intergenic
940426373 2:153535806-153535828 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
940508422 2:154584197-154584219 AATCACCCAAGCAGTTTCTCAGG - Intergenic
940530517 2:154871739-154871761 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
940675495 2:156721346-156721368 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
941340717 2:164300266-164300288 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
941455739 2:165710850-165710872 AATCACCCAAGTAGTTTCTCAGG - Intergenic
941751015 2:169135513-169135535 AGTCACCCAAGCAGTTTCTCAGG + Intronic
942729935 2:179052836-179052858 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
943061954 2:183048754-183048776 AATCACCCAAGCAGTTTATAAGG + Intergenic
943412534 2:187561210-187561232 AATCACCCAAGCAATTTCTCAGG - Intronic
943421256 2:187671774-187671796 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
943460794 2:188169950-188169972 AATCAGCCAAGCATTTTTTCAGG - Intergenic
943806959 2:192134852-192134874 AATCAGCCAAGCATTTTTTCAGG + Intronic
943835723 2:192511896-192511918 AATCAGCCAAGCATTTTTTCAGG + Intergenic
943950950 2:194131959-194131981 AATCAGCCAAACAGTTTTTTAGG - Intergenic
944251484 2:197583467-197583489 AATCACCCCAGCAGTTTCTCAGG + Intronic
944273290 2:197805915-197805937 AATCCCCCAAGCATTATCACTGG + Intronic
944387839 2:199184355-199184377 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
945152782 2:206808145-206808167 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
945173825 2:207022045-207022067 AATCAGCCAAGCATTTTTTCAGG + Intergenic
945301095 2:208217143-208217165 AATCAGCCAAGCATTTTTTCAGG - Intergenic
945359010 2:208873248-208873270 TTTCACCCAAGCCATTTCTCTGG + Intergenic
945362020 2:208904206-208904228 AATCAGCCAAGCATTTTTTCAGG + Intergenic
945376494 2:209083054-209083076 AATCAGCCAAGCATTTTTTCAGG + Intergenic
945394618 2:209303625-209303647 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
945938645 2:215926804-215926826 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
946090565 2:217219071-217219093 AATTACCCAAGCAGCAACTCTGG - Intergenic
946214712 2:218175301-218175323 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
946780542 2:223189972-223189994 AATCAGCCAAGCATTTTTTCAGG - Intronic
946871322 2:224088310-224088332 AATCACCCAAGCAGTTTCTCAGG - Intergenic
946893599 2:224301094-224301116 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
947842388 2:233216377-233216399 AATCACCTGAGCAGTTTCTCAGG - Intronic
948391017 2:237611374-237611396 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1168985349 20:2043668-2043690 AGTCACCTAAGGAGTTTCTGGGG - Intergenic
1169593200 20:7168129-7168151 TATCACCCCAGCATTTTCTTTGG - Intergenic
1169609830 20:7365884-7365906 AACCATCCAAGGAGTTTCTTAGG + Intergenic
1170068540 20:12341557-12341579 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1170106559 20:12758304-12758326 AATCAGCCGAGCAGTTTTTCAGG + Intergenic
1170166063 20:13361374-13361396 AATCAGCCGAGCAGTTTTTCAGG + Intergenic
1170325134 20:15148899-15148921 AAACAGCCACGCAGTTTTTCAGG - Intronic
1170400608 20:15979173-15979195 AATAACCCCAACAGTTTCACTGG + Intronic
1170680012 20:18518113-18518135 AATCACCCAAACAGTTTTTCAGG - Intronic
1172932088 20:38593659-38593681 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1173102226 20:40097768-40097790 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1173119186 20:40273437-40273459 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1173455550 20:43198563-43198585 AATCATCTAAGAAGTTTCTGGGG + Intergenic
1173652505 20:44675727-44675749 AATCACCCAAGCCGTTTCTCAGG + Intergenic
1173763424 20:45585279-45585301 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1173782045 20:45764086-45764108 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1173836637 20:46130328-46130350 CTTCCCCCAAGCAGTATCTCAGG + Intergenic
1175615894 20:60397933-60397955 AATCACGCAGGCAGGTTCCCTGG - Intergenic
1175912532 20:62411686-62411708 GATCGCCACAGCAGTTTCTCAGG + Intronic
1176686045 21:9849386-9849408 AATCCCCCAAGCATTTTCTTAGG + Intergenic
1177030807 21:15980871-15980893 AATCACCCAAGTAGTTTCTCAGG - Intergenic
1177101001 21:16896967-16896989 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1177103040 21:16918626-16918648 ATCCAGCCAAGCAGTTTTTCAGG + Intergenic
1177119973 21:17126475-17126497 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1178001527 21:28165629-28165651 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1178363326 21:31968128-31968150 GATCACCCCAGCAGTGACTCGGG + Intronic
1179387885 21:40959376-40959398 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1181934322 22:26428447-26428469 ACCCACCCATGCAGTTTCCCTGG + Intergenic
1182155517 22:28068637-28068659 AATCACCAAAGCAATTACTTAGG + Intronic
1182732604 22:32507196-32507218 AATCAGCCAATTAGTTTTTCAGG + Intergenic
1182998931 22:34838741-34838763 AACCAGCCAAGCATTTTTTCAGG + Intergenic
1183635197 22:39057830-39057852 AATCACCCAAGAAGGTTCTCAGG - Intronic
949161763 3:891952-891974 AATCAGCCAAGAAGTTTTTCAGG - Intergenic
949671489 3:6402104-6402126 AAATCACCAAGCAGTTTCTCAGG + Intergenic
949827766 3:8181435-8181457 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
950926818 3:16748741-16748763 AATCAGCCAAGCAGTTTCTCAGG + Intergenic
951298490 3:20968796-20968818 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
951315962 3:21190269-21190291 AATCAGCCAAGCATTTTTTCAGG - Intergenic
951762358 3:26160914-26160936 AATCACCCAAGCAGCTTCTCAGG - Intergenic
951895019 3:27602115-27602137 AATCACCCAAGCAATTTCTCAGG + Intergenic
952183202 3:30941447-30941469 AATAACCCAAGTACTTCCTCTGG - Intergenic
952266564 3:31792569-31792591 AATCACCCACCCAGTGTGTCTGG - Intronic
952297332 3:32072935-32072957 AATCACCCAAGCAGTTTCTCAGG + Intronic
952343194 3:32462203-32462225 AATCAGCCAAGCATTTTTTCAGG - Intronic
952564783 3:34641776-34641798 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
952663141 3:35875613-35875635 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
952895731 3:38077561-38077583 AATCAGCCAAGCAGTTTTTCAGG - Intronic
953076807 3:39579091-39579113 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
953177518 3:40565398-40565420 AATCAGCCAAGCAGTTTTTGAGG + Intronic
953275831 3:41496436-41496458 AACCACCCCAGCATTTTGTCTGG + Intronic
953599089 3:44346236-44346258 AATCACCCAAGCAGTTTCTCAGG - Intronic
953656091 3:44856038-44856060 AATCACCCAAGCAGTTTCTCAGG - Intronic
953825387 3:46247579-46247601 AATCAGCCAAGCAGTTTTTCAGG - Intronic
954686795 3:52375397-52375419 ACTCACCCAACCAGTTGCCCAGG - Exonic
954968953 3:54635776-54635798 AATCAGCCAAGCAGTTTTTCAGG - Intronic
955253744 3:57308303-57308325 AATCACCCAAGCAGTTCCTCAGG + Intronic
956233116 3:67039511-67039533 AATCACCCAAGCAGTTTTTCAGG - Intergenic
956548633 3:70435934-70435956 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
956665496 3:71638290-71638312 ACTCACCCAACTACTTTCTCTGG - Intergenic
956709588 3:72027626-72027648 AATCAGCCAAGCATTTTTTCAGG + Intergenic
957059556 3:75471153-75471175 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
957316987 3:78584426-78584448 AATCCGCCAAGCAGTTTTTCAGG - Intergenic
957451851 3:80389845-80389867 AATCACCCAAGCAGTTTCTCAGG + Intergenic
957734493 3:84188686-84188708 AATCACCCAAGCAGTTTCTCAGG - Intergenic
957904400 3:86538734-86538756 AAATCACCAAGCAGTTTCTCAGG - Intergenic
957986089 3:87574153-87574175 AATCATCCAAGCAGTTTCTCAGG + Intergenic
958173512 3:89966244-89966266 AATTACCCAATCACTTTCTATGG - Intergenic
958183193 3:90085489-90085511 AATCAGCCAAGCATTTTTTCAGG + Intergenic
958676396 3:97273708-97273730 AATCAGCCAAGCAGTTTTTCAGG - Intronic
960282548 3:115794785-115794807 AATCAGCCAAGCAGGTTTTCAGG - Intergenic
960309802 3:116106603-116106625 AATCAGCCAAGCATTTTCTCAGG - Intronic
961164434 3:124753848-124753870 AATCAGCCAATTAGTTTTTCAGG - Intergenic
961293842 3:125868232-125868254 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
961711305 3:128830485-128830507 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
961712316 3:128837072-128837094 AATCACCCAAGCAGTTTCTCAGG - Intergenic
961730909 3:128964112-128964134 AATCAGCCAAGCAGTTTTTCAGG + Intronic
961881372 3:130063692-130063714 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
962205915 3:133433709-133433731 AATCAGCCAAGCATTTTTTCAGG + Intronic
962523528 3:136218467-136218489 AATCACCCAAGCAGTTTCTCAGG - Intergenic
962661002 3:137600114-137600136 AATCAGCCAAGCATTTTTTCAGG + Intergenic
963320201 3:143802646-143802668 AATTACCCAAGCAGTTTCTCAGG + Intronic
963424803 3:145112524-145112546 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
963456349 3:145552477-145552499 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
963468931 3:145714821-145714843 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
963520799 3:146358193-146358215 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
963521981 3:146366693-146366715 AATCAGCCAAGCAGGTTTTCAGG + Intergenic
963663677 3:148156075-148156097 AATCAGCCAAGCAGGTTTTCAGG + Intergenic
963684646 3:148418773-148418795 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
963928477 3:150977081-150977103 AATCAGCCATGCAGTGTCCCTGG - Intergenic
964068214 3:152601874-152601896 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
964906209 3:161723171-161723193 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
964940525 3:162154663-162154685 AATCACGCAAGCAGTTTCTCAGG - Intergenic
965070728 3:163912709-163912731 AATCAGCCAAGCAGTTGTTCAGG + Intergenic
965104918 3:164343417-164343439 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
965262286 3:166501853-166501875 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
965286412 3:166825383-166825405 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
965336691 3:167435856-167435878 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
965624509 3:170673440-170673462 AATCAGCCAAGCATTTTTTCAGG - Intronic
965625996 3:170684617-170684639 AATCAGCCAAGCATTTTTTCAGG - Intronic
965639653 3:170818868-170818890 AATCAGACAAGCAGTTTTTCAGG - Intronic
965713737 3:171580845-171580867 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
965861562 3:173156486-173156508 AATCACCCAAGCAGTTTCTCAGG - Intergenic
966067261 3:175832935-175832957 AATCACCCAAGCAGTTTCTCAGG + Intergenic
966085807 3:176066059-176066081 AATCAGCCAAGCATTTTTTCAGG + Intergenic
966104777 3:176322923-176322945 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
966232530 3:177667137-177667159 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
966397218 3:179516244-179516266 AATCACCCAAGCAGTTTCTCAGG - Intergenic
967004919 3:185375070-185375092 AATCACCCAAGCAGTTTCTCAGG - Intronic
967152458 3:186662443-186662465 AATCAGCCAAGCAGTTTTTCAGG + Intronic
967211839 3:187176813-187176835 AATCAGCCAAGCAGTTTTTCAGG - Intronic
967243856 3:187467557-187467579 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
967496547 3:190148925-190148947 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
967561706 3:190924536-190924558 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
967624298 3:191667561-191667583 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
967643496 3:191896627-191896649 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
967657784 3:192072373-192072395 AATCAGCCAAGTAGTTTTTCAGG - Intergenic
967740789 3:193000111-193000133 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
968993698 4:3931797-3931819 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
969003463 4:4001333-4001355 AATCAGCCAAGCATTGTTTCAGG - Intergenic
969653701 4:8483696-8483718 AATCAGCCAAGCAGTTTTTCAGG - Intronic
969750547 4:9107193-9107215 AGTCAGCCAAGCATTTTTTCAGG + Intergenic
970042387 4:11810705-11810727 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
970087900 4:12368404-12368426 AATCAGCCAAGCATTTTTTCAGG + Intergenic
970256026 4:14171252-14171274 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
970533124 4:17002646-17002668 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
970819432 4:20195921-20195943 GGTCACTCAAGCAGTCTCTCAGG + Intergenic
970853667 4:20631025-20631047 AATCAGCCAAGCATTTTTTCAGG - Intergenic
971179766 4:24318312-24318334 AATGACACAAGCTGTTTCTAAGG + Intergenic
971180794 4:24327007-24327029 AATCAGCCAAGCATTTTTTCAGG + Intergenic
971200456 4:24505431-24505453 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
971553300 4:27980294-27980316 AATCACCCAAGCAGTTTCTCAGG + Intergenic
974173074 4:58292368-58292390 AATCACCCAAGCAGTTTCTCAGG - Intergenic
974428078 4:61765546-61765568 AATCAGCCAAGCAGTTTTTCAGG - Intronic
974904225 4:68035952-68035974 AATCACCCAAGCAGTTTCTCAGG + Intergenic
975864772 4:78715145-78715167 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
975933565 4:79555261-79555283 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
976558935 4:86479222-86479244 AATCACCCAAGCAGTTTCTCAGG + Intronic
976697846 4:87937220-87937242 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
976719168 4:88153578-88153600 AATCAGCCAAGCAGTTTTTCGGG - Intronic
976884240 4:89966046-89966068 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
977010629 4:91628501-91628523 AATCAGCCAAGCATTTTTTCAGG + Intergenic
977012604 4:91655905-91655927 AATCAGCCAAGCAGCTTTTCAGG - Intergenic
977051099 4:92129276-92129298 AATCACCCAAGCCTACTCTCTGG + Intergenic
977062184 4:92272790-92272812 AATCAGCCAATTAGTTTTTCAGG - Intergenic
977074881 4:92440255-92440277 AATCAGCCAAGCAGTTTTTCAGG - Intronic
977198111 4:94085914-94085936 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
977216838 4:94294537-94294559 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
977224947 4:94384198-94384220 AATCAGCCAAGCATTTTTTCAGG - Intergenic
977377369 4:96223015-96223037 AATAACCAAACCAGTTACTCTGG - Intergenic
978000798 4:103555052-103555074 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
978031849 4:103945768-103945790 AATCATCCAAGCAATTTCTCAGG + Intergenic
978302895 4:107291582-107291604 AATCAGCTAAGCAGTTTCTCAGG - Intergenic
979054296 4:115976952-115976974 AATCAACCAAGCAGTTTTTCAGG - Intergenic
979146932 4:117256513-117256535 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
979171035 4:117601388-117601410 AATCACCCAAGCAATTTCTTAGG - Intergenic
979380257 4:119998348-119998370 AATCAGCTAAGCAGTTTTTCAGG + Intergenic
979849986 4:125562918-125562940 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
979894848 4:126146420-126146442 AATCAGCCAAGCATTTTTTCAGG - Intergenic
980002989 4:127512235-127512257 AATCAGCCAAGCATTTTTTCAGG - Intergenic
980111591 4:128642150-128642172 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
980297968 4:130947347-130947369 AATCACCCAAGCAGTTTCTCAGG + Intergenic
980349503 4:131667860-131667882 AATCACCCAAGCAGTTTCTTAGG + Intergenic
980389244 4:132122616-132122638 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
980472070 4:133264777-133264799 AATCACCCAAGCAGTTTCTCAGG - Intergenic
980528243 4:134017102-134017124 AATCAGCCAAGCATTTTTTCAGG + Intergenic
980571373 4:134624475-134624497 AATCTCCCAAACAGTTGCACAGG - Intergenic
980575312 4:134679197-134679219 AATCAGCCAAGCATTTTTTCAGG - Intergenic
980904263 4:138932290-138932312 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
980928127 4:139158966-139158988 AATCACCCAAGCAGTTTCTCAGG - Intronic
981040572 4:140217920-140217942 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
981540039 4:145837172-145837194 AATCAGCCAAGCAGTTTTTCAGG + Intronic
982083631 4:151813734-151813756 AATCAGCCAAGCAGTTTTTCGGG - Intergenic
982180156 4:152742621-152742643 AATCAGCCAAGCAGTTTTTCAGG - Intronic
982319263 4:154061658-154061680 AATCACCCAAGCAATTTCTCAGG + Intergenic
982323577 4:154106152-154106174 AAACACCCATGCTATTTCTCAGG - Intergenic
982396341 4:154919583-154919605 AATCAGCCAAGCATTTTTTCAGG - Intergenic
982496795 4:156104727-156104749 AATCAGCCAAGCATTTTTTCAGG - Intergenic
982535764 4:156604709-156604731 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983024202 4:162713523-162713545 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983056221 4:163101600-163101622 AATCACCCAAGCAGTTTCTCAGG - Intergenic
983345920 4:166525160-166525182 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983360737 4:166720730-166720752 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983414426 4:167437297-167437319 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
983448382 4:167880752-167880774 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983452662 4:167927317-167927339 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983542880 4:168931422-168931444 AATCTCCCAAGCTGTTTCTCAGG - Intronic
983577431 4:169273616-169273638 AATCACCCAGGCAGTTATTCTGG + Intergenic
983659896 4:170120874-170120896 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
983773767 4:171581659-171581681 AAAAACCCATGCAGTTTCTAGGG + Intergenic
983805470 4:171987317-171987339 AATCAGCCAAGCAGTTTTTCAGG - Intronic
983883340 4:172956893-172956915 AATCACCCAAGCAGTTTCTCAGG - Intronic
984098686 4:175462471-175462493 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
984322580 4:178212059-178212081 AATCACCCAAGTGCTTTCTCAGG + Intergenic
984437692 4:179725619-179725641 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
985057035 4:186045274-186045296 AATCAGCCAAACAGTTTTTCAGG - Intergenic
985078594 4:186242885-186242907 AATCACCCAAGCAGTTTCTCAGG - Intronic
985389536 4:189480657-189480679 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
985436083 4:189930584-189930606 AATCAGCCAAGCATTTTTTCAGG + Intergenic
985495252 5:200483-200505 AATCCCCAAACCAGCTTCTCTGG - Exonic
985582670 5:707214-707236 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
985787233 5:1903390-1903412 AATTACCCCATCAGCTTCTCTGG - Intergenic
986193845 5:5519965-5519987 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
986368526 5:7058668-7058690 AATCACCCGAGCAGTTTCTCAGG - Intergenic
986389196 5:7268010-7268032 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
986554686 5:8999618-8999640 AATCAGCCAAGCATTTTTTCAGG - Intergenic
986919263 5:12663821-12663843 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
987282319 5:16424144-16424166 AATCAGCCGAGCAGTTTTTCAGG + Intergenic
987487150 5:18538098-18538120 ATTCAGCCAAGCAGTTTTTCAGG + Intergenic
987487808 5:18542737-18542759 GATCAGCCAAGCATTTTTTCAGG + Intergenic
987497809 5:18670143-18670165 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
987756150 5:22099267-22099289 AATCACCCAAGCAGTTTCTCAGG + Intronic
988199528 5:28050841-28050863 AATCACCCAAGCAGTTTCTCAGG + Intergenic
988199543 5:28050949-28050971 AATCACCCAAGCCATTTCTCAGG + Intergenic
992394986 5:76361757-76361779 AATCAGCTAAGCAGTTTTTCAGG + Intergenic
992451608 5:76881197-76881219 AATCACCCAAGCAGTTTCTCAGG - Intronic
992961196 5:81957954-81957976 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
993193027 5:84702904-84702926 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
993837007 5:92828385-92828407 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
994125698 5:96167613-96167635 AATCACCCAAGCAGTTTTTCAGG - Intergenic
994295531 5:98084051-98084073 AATCAGCCAAGCATTTTTTCAGG + Intergenic
994375372 5:99012099-99012121 AATCACCCAAGCAGTTTCTTAGG - Intergenic
994490441 5:100436197-100436219 AATTACATAACCAGTTTCTCTGG + Intergenic
994532236 5:100985531-100985553 AATCAGCCAAGCATTTTTTCAGG - Intergenic
994557237 5:101319331-101319353 AATCAGCCAAGAAGTTTTTCAGG + Intergenic
994775999 5:104036034-104036056 AATCAGCCAAGAAGTTTTTCAGG + Intergenic
994778566 5:104064928-104064950 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
994989861 5:106982768-106982790 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
995122828 5:108553723-108553745 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
995296988 5:110534259-110534281 AATCAGCCAAGCATTTTTTCAGG + Intronic
995629010 5:114112583-114112605 AATCGCCCAAAAAGTATCTCAGG - Intergenic
995899049 5:117047660-117047682 AATCAGCCAAGCATTTTTTCAGG - Intergenic
996202940 5:120698874-120698896 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
996344588 5:122475498-122475520 TATCAGCCAAGCAGTTTTTCAGG - Intergenic
996358295 5:122620167-122620189 AATCACCCAAGCAGTTTCTCAGG - Intergenic
996510218 5:124308204-124308226 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
996528366 5:124501473-124501495 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
996574632 5:124967636-124967658 AATCACCCAAGCAGTTTCTCAGG - Intergenic
996745078 5:126840630-126840652 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
996918052 5:128734310-128734332 AATCACACAAGCAATTTCTCAGG + Intronic
997678399 5:135732252-135732274 AATCACCCAAGCAGTTTCTCAGG - Intergenic
997746720 5:136305735-136305757 AATCAGCCAAGCAGTTTTTCAGG + Intronic
997770306 5:136547616-136547638 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
997772331 5:136566632-136566654 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
998633405 5:143926060-143926082 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
998693370 5:144612601-144612623 AATCACCCGAGCAGTTTCTCAGG - Intergenic
998995705 5:147867712-147867734 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
999271036 5:150296575-150296597 AATGGCCCAGCCAGTTTCTCTGG + Exonic
999618556 5:153450993-153451015 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1000438947 5:161244938-161244960 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1000440135 5:161253731-161253753 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1000519077 5:162276689-162276711 AATCAGCCAAGCACTTTTTCAGG - Intergenic
1000777326 5:165436578-165436600 AATCACACATGGAATTTCTCTGG - Intergenic
1000935319 5:167299209-167299231 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1001181418 5:169524380-169524402 AATCACACAAGCAGCTTTCCTGG - Intergenic
1001331128 5:170763290-170763312 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1001353841 5:171001745-171001767 AATCACCCAAGCAGTTTCTCAGG - Intronic
1003100462 6:3172581-3172603 AATCACCCAAGCAGGTTTTCAGG + Intergenic
1003429854 6:6029081-6029103 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1004106584 6:12671783-12671805 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1004283197 6:14298243-14298265 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1004507675 6:16260278-16260300 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1004575552 6:16890370-16890392 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
1004768251 6:18755385-18755407 AATCAGCCAAGTATTTTTTCAGG - Intergenic
1004837364 6:19543541-19543563 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1005014331 6:21362793-21362815 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1005786112 6:29247569-29247591 AATCACCCAAGCTGTCTCTCAGG - Intergenic
1006325228 6:33348631-33348653 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1006641898 6:35493941-35493963 CATCCCCCATGCAGGTTCTCAGG + Intronic
1007084308 6:39132494-39132516 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1007300522 6:40864627-40864649 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1007995369 6:46302204-46302226 AATCACCCGCCCAGTTGCTCAGG - Intronic
1008476963 6:51943139-51943161 AATCACCCAAGCAGTTTCTCAGG + Intronic
1008923142 6:56863610-56863632 AAACACCCAAGCAATATTTCAGG - Intronic
1009270196 6:61604938-61604960 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1009283334 6:61779304-61779326 AATAACCCATGGAGTTTCTATGG + Intronic
1009343652 6:62588486-62588508 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1009359684 6:62796172-62796194 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1009379514 6:63010151-63010173 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1009591265 6:65673692-65673714 AATCACCCAAGCAGTTTCTCAGG - Intronic
1010071359 6:71749639-71749661 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1010427946 6:75747551-75747573 AGTCACCTAACCAGTTTCCCAGG - Intergenic
1010586295 6:77661281-77661303 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1010662545 6:78587187-78587209 AATCAGCCGAGCATTTTTTCAGG + Intergenic
1010826627 6:80484035-80484057 AATCAGCCGAGCATTTTTTCAGG - Intergenic
1010829319 6:80511043-80511065 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1010840950 6:80648795-80648817 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1010894225 6:81346435-81346457 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1010923559 6:81715097-81715119 AATGACACAAGCAGATTTTCAGG + Intronic
1011367542 6:86599448-86599470 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1011770623 6:90671501-90671523 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1012014076 6:93831359-93831381 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1012066219 6:94555229-94555251 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1012316132 6:97784005-97784027 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1013407567 6:109857037-109857059 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1013807653 6:114012845-114012867 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1013892029 6:115036301-115036323 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1014114892 6:117660072-117660094 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1014396392 6:120929595-120929617 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1014454550 6:121621722-121621744 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1014556166 6:122844248-122844270 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1014612423 6:123561220-123561242 AATCACCCAAGCAGTTTTTCAGG + Intronic
1014614348 6:123583580-123583602 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1014719215 6:124896461-124896483 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1014793666 6:125703152-125703174 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1014891861 6:126853165-126853187 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1015165561 6:130196952-130196974 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1015269968 6:131327818-131327840 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1015271692 6:131343293-131343315 AATCAGCCAAGCATTTTCTCAGG + Intergenic
1015278473 6:131407238-131407260 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1015324148 6:131906107-131906129 AATCAGCCAAGCAGCTTTTCAGG + Intergenic
1015800965 6:137061866-137061888 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1016113823 6:140258737-140258759 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1016204881 6:141457452-141457474 AATCACCGAAGCAGTTTCTCAGG + Intergenic
1016249219 6:142020447-142020469 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1016519125 6:144927596-144927618 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1016535433 6:145104440-145104462 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1016649974 6:146451708-146451730 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1016751097 6:147631522-147631544 AATCACCCAAGCAGTTTCTCAGG - Intronic
1016853596 6:148644225-148644247 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1017389828 6:153925916-153925938 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1017633719 6:156423456-156423478 GATCACCCGAGCAGAGTCTCGGG - Intergenic
1017744543 6:157435093-157435115 AATCGCCATAGCAGTTCCTCGGG + Intronic
1017779019 6:157701941-157701963 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1017922424 6:158883924-158883946 AATCACCCAAGCAGTTTCTCAGG - Intronic
1018077998 6:160233351-160233373 AATCACCCAAGCAGTTTCTCAGG + Intronic
1018084173 6:160287863-160287885 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1018495074 6:164340026-164340048 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1018521142 6:164653403-164653425 AATCAGGCAAGCAGTTTTTCAGG - Intergenic
1020322433 7:6949445-6949467 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
1020532390 7:9354707-9354729 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1020540700 7:9459003-9459025 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1021173112 7:17419064-17419086 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1021393996 7:20125241-20125263 AATCACCCAAGCAGTTTCCCAGG + Intergenic
1021430234 7:20550421-20550443 AATCAGCCCAGCAGTTTTTCAGG + Intergenic
1021632465 7:22660577-22660599 AGACACCCAAGCAGTTTACCTGG - Intergenic
1021637708 7:22708043-22708065 AATCAGCCAAGGAGTTTTTCAGG + Intergenic
1021660990 7:22917706-22917728 AATCGCCCAAGCAGTTTCTCAGG + Intergenic
1021810968 7:24400673-24400695 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1021977583 7:26025486-26025508 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1022373191 7:29789258-29789280 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1022447812 7:30484201-30484223 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1022854428 7:34301417-34301439 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1023698567 7:42871898-42871920 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1024738827 7:52334217-52334239 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1024769013 7:52696313-52696335 AACCACCCAAGCAGTTTGTCTGG - Intergenic
1025708987 7:63890721-63890743 GCTCGCCCAGGCAGTTTCTCTGG - Intergenic
1025790607 7:64684013-64684035 AATCACCCAGGCAGTTTCCCAGG + Intronic
1027158777 7:75787245-75787267 AATCACCCAAGCAGTTTCTCAGG + Intronic
1027354753 7:77344212-77344234 AATCACCCAAGCAGTTTCTCAGG + Intronic
1027852273 7:83464088-83464110 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1028589435 7:92480136-92480158 AATCACCTGAGCAGTTTTTCAGG - Intergenic
1028670827 7:93398355-93398377 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1028690490 7:93644279-93644301 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1029500586 7:100926783-100926805 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1030193943 7:106835025-106835047 TATCACCCAAGCTGCTTCTCAGG + Intergenic
1030441335 7:109593113-109593135 AATCAGCCAAGCACTTTTTCAGG - Intergenic
1030445471 7:109643361-109643383 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1030960517 7:115915068-115915090 ATTCACAAAAGCAGTTTCTCTGG - Intergenic
1031004987 7:116459942-116459964 AATCAGCCAAGCATTTTTTCAGG + Intronic
1031067229 7:117118054-117118076 AAACATCCAAGTATTTTCTCTGG - Intronic
1031354806 7:120777866-120777888 AATCAGCCAAACATTTTTTCAGG - Intergenic
1031364445 7:120886919-120886941 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1031400301 7:121319981-121320003 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1031525966 7:122821677-122821699 AATCAGCCAAGCAGTTTTTCAGG + Intronic
1031686166 7:124733452-124733474 AATCAGCCAAGCAGTGTTTCAGG + Intergenic
1031704233 7:124961629-124961651 AATCCCCCAAGCAGTTTCTCAGG - Intergenic
1031704244 7:124961710-124961732 AATCCCCCAAGCAGTTTCTCAGG - Intergenic
1031727622 7:125260192-125260214 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1031776636 7:125914417-125914439 AATCAGCCAAGCAGTGTTTCAGG + Intergenic
1031777772 7:125922828-125922850 AATCACGCAAGCAGTTTCTCAGG + Intergenic
1033211952 7:139466399-139466421 AATCACCCAAGCAGTTTCTCAGG + Intronic
1033464609 7:141579343-141579365 AATCACCCAAGCAGTTTCTCAGG - Intronic
1033675626 7:143538514-143538536 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1033696208 7:143790930-143790952 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1033909148 7:146244670-146244692 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1034552156 7:151827984-151828006 AATCACCCTGGGAGTTTTTCTGG - Intronic
1034566567 7:151920289-151920311 TAAAACCCACGCAGTTTCTCAGG - Intergenic
1035136002 7:156703654-156703676 CCTCACCCAAGCATTTTCCCAGG + Intronic
1035880304 8:3239247-3239269 AATCAGCCAAGCATTTTTTCAGG - Intronic
1036066111 8:5383354-5383376 AAACACGAAATCAGTTTCTCTGG - Intergenic
1036070565 8:5437716-5437738 AGTCAGCCAAGCAGTTTTTCAGG - Intergenic
1036281798 8:7406853-7406875 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1036339673 8:7904718-7904740 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1036373611 8:8181525-8181547 AGTCAGCCAAGCATTTTTTCAGG + Intergenic
1036471937 8:9060162-9060184 AATCACCCAAGCAGTTTCTCAGG - Intronic
1036550099 8:9808057-9808079 AGTCACCCAAGCAGTTTCTCAGG + Intergenic
1036639851 8:10576066-10576088 AATCAGCCCAGCAGTTTTTCAGG + Intergenic
1036877295 8:12484116-12484138 AGTCAGCCAAGCATTTTTTCAGG - Intergenic
1038388323 8:27170984-27171006 AATCACACAAGCACTTTCTTTGG + Intergenic
1038541656 8:28395013-28395035 GAGCCCCCAATCAGTTTCTCTGG - Intronic
1039957740 8:42220224-42220246 AATGATCAAATCAGTTTCTCAGG - Intergenic
1040648432 8:49424719-49424741 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1040662643 8:49594043-49594065 AAACACACAAGCAGTTTATTAGG - Intergenic
1041651418 8:60307015-60307037 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1041917100 8:63148885-63148907 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1042159525 8:65877984-65878006 AATCAACCCAGCAGGTGCTCTGG - Intergenic
1042453881 8:68977568-68977590 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1042706517 8:71669502-71669524 AATCACCCAAGCAGTTTTTCAGG + Intergenic
1042707694 8:71679338-71679360 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1043353347 8:79387393-79387415 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1043599291 8:81918643-81918665 AATCACCCAAGCAGTGTCTCAGG + Intergenic
1043717514 8:83505947-83505969 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1043721240 8:83548530-83548552 AATCACCCAGGCAGTTTCTCAGG + Intergenic
1043838110 8:85067894-85067916 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1044148200 8:88743502-88743524 AGTCAGCCAAGCAGTTTTTCAGG - Intergenic
1044922313 8:97179498-97179520 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1044925480 8:97205344-97205366 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1045197851 8:99948293-99948315 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1045249099 8:100468190-100468212 AAACCCCCAAGCAGATTCTTGGG - Intergenic
1045533220 8:103003615-103003637 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1045645108 8:104290358-104290380 AATTACCCAAGCAGTTTCTCAGG + Intergenic
1046294449 8:112200249-112200271 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1046386027 8:113510799-113510821 AATCAGCCAAGCAGATTTTCAGG - Intergenic
1046440331 8:114245762-114245784 AAACAGCCAAGCAGTTTTTCAGG + Intergenic
1046443574 8:114286414-114286436 AAACAGCCAAGCAGTTTTTCAGG + Intergenic
1046512404 8:115216652-115216674 AAACAGCCAAGCAGTTTTTCAGG + Intergenic
1046755059 8:117964071-117964093 ATTCCCCAAAGCAGTTTCTTTGG - Intronic
1047699672 8:127436144-127436166 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1047829223 8:128613200-128613222 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1048097914 8:131314624-131314646 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1048135807 8:131745353-131745375 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1048144125 8:131823823-131823845 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1048168119 8:132081518-132081540 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1048568366 8:135627725-135627747 CAGCACCCCAGAAGTTTCTCTGG + Intronic
1048585110 8:135768425-135768447 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1048763876 8:137825894-137825916 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1049868448 8:144955172-144955194 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1050117986 9:2280197-2280219 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1050140922 9:2514833-2514855 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1050257710 9:3812148-3812170 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1050490742 9:6185436-6185458 AATCACCTATGCAGTTTCCTTGG - Intergenic
1050896423 9:10889441-10889463 AATCACCCAAGCAGTTTTTCAGG + Intergenic
1051040652 9:12806031-12806053 ATTCACCCCAGGAGTTTCTTGGG + Intronic
1051052954 9:12952769-12952791 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1051581890 9:18685523-18685545 TATGACCCAAGAAATTTCTCAGG + Intronic
1051685148 9:19650532-19650554 TCACACCCAAGCTGTTTCTCTGG - Intronic
1051953067 9:22659772-22659794 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1052114320 9:24630879-24630901 AAGCAGGCAAGCTGTTTCTCTGG + Intergenic
1052163500 9:25292871-25292893 AATCAGCCAAGCATTTTCTCAGG + Intergenic
1052192216 9:25673898-25673920 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1052653742 9:31331373-31331395 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1052720288 9:32165626-32165648 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1053058381 9:35008120-35008142 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1053469457 9:38335819-38335841 GCTCACCCAAGCAGTTTCCAAGG - Intergenic
1053783270 9:41632212-41632234 AATCACCCAAGCAGTTTCTTAGG - Intergenic
1054171222 9:61842354-61842376 AATCACCCAAGCAGTTTCTTAGG - Intergenic
1054666310 9:67738458-67738480 AATCACCCAAGCAGTTTCTTAGG + Intergenic
1054807114 9:69405826-69405848 AATCAGCTAAGCATTTTTTCAGG - Intergenic
1055233390 9:74090085-74090107 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1055555513 9:77469634-77469656 AATCGCCCAAGCATTTAATCAGG + Intronic
1055627109 9:78185541-78185563 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1055810376 9:80141839-80141861 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1055882122 9:81013998-81014020 AATTAGCCAAGCAGTTTTTCAGG + Intergenic
1056061473 9:82888169-82888191 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1056324285 9:85463629-85463651 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1056363291 9:85880178-85880200 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1056522765 9:87415351-87415373 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1056883292 9:90417002-90417024 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1057235162 9:93352024-93352046 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1057378306 9:94544232-94544254 AATCAGGCAAGCAGTTTTTCAGG + Intergenic
1057684235 9:97218654-97218676 AATCAGGCAAGCAGTTTTTCAGG + Intergenic
1057982410 9:99674578-99674600 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1058025804 9:100141435-100141457 AATCAGCCAAGCATTTTTTCAGG - Intronic
1058612753 9:106792981-106793003 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1059545849 9:115175910-115175932 AATCAGCCAAGCATTTTTTCAGG - Intronic
1059574934 9:115477768-115477790 AACCAGCCAAGCATTTTTTCAGG + Intergenic
1059606385 9:115840483-115840505 AATCAACCAAGCAGTTTTTCAGG - Intergenic
1059667562 9:116463205-116463227 CATCTCCCAACCAGTCTCTCAGG + Intronic
1059863137 9:118486746-118486768 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1060226536 9:121794752-121794774 AATCACCCAAGCAGTTCCTCAGG + Intergenic
1060318102 9:122531738-122531760 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1060737512 9:126075698-126075720 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1062692423 9:137849463-137849485 AATCACCCAAGCTGTTTCTCAGG + Intronic
1185887215 X:3793397-3793419 AATCTTCCCAGCAGTTTCCCAGG + Intergenic
1185960370 X:4541777-4541799 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1185991389 X:4896006-4896028 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1186112531 X:6273473-6273495 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1186784404 X:12944255-12944277 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1187086199 X:16045977-16045999 AATCAGCCAAGCAATTTTTCAGG - Intergenic
1187099651 X:16180469-16180491 AATCAGCCAAGCAATTTTTCAGG - Intergenic
1187790117 X:22941601-22941623 CATCACCCAAGCAGTATCCATGG + Intergenic
1187808232 X:23144783-23144805 ACTCACACCAGCAGTCTCTCTGG + Intergenic
1188200495 X:27289496-27289518 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1188264264 X:28051521-28051543 ACTCACCCAAGCACTGTCTAGGG - Intergenic
1188300714 X:28503652-28503674 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1188332606 X:28893359-28893381 AATCACCCAAGCAGTTTCTCAGG - Intronic
1188419869 X:29979966-29979988 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1188431394 X:30107978-30108000 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1188463030 X:30450192-30450214 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1188553024 X:31382098-31382120 AATCACCCAAGCAGTTTCTCAGG + Intronic
1191761740 X:64654320-64654342 AATCACCCAAGCAGTTTCTTGGG + Intergenic
1191805377 X:65130252-65130274 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1191826000 X:65365080-65365102 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1192455215 X:71270290-71270312 AATCAACCAAGCAGTTTGCCAGG + Intergenic
1192706562 X:73532725-73532747 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1192731108 X:73803485-73803507 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1192935862 X:75858090-75858112 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1193537511 X:82732028-82732050 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1193886248 X:86986227-86986249 AATCAGCCAAGCACTTTTTCAGG + Intergenic
1193941819 X:87686319-87686341 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1194185923 X:90774614-90774636 AATCAGCCAAGCAGCTTTTCAGG - Intergenic
1194293295 X:92101531-92101553 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1194308221 X:92274357-92274379 AATCAGCCAAGCAGTTTTTCAGG - Intronic
1194367424 X:93027353-93027375 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1194502659 X:94700108-94700130 AATCAGCCAAGGAGTTTTTCAGG - Intergenic
1194661118 X:96629222-96629244 AATCAGCCAAGCGGTTTTTCAGG + Intergenic
1194802214 X:98287931-98287953 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1194822455 X:98525551-98525573 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1194873376 X:99159973-99159995 AATCAGCCAAGCATTTTTTCAGG - Intergenic
1195016670 X:100788002-100788024 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1195290767 X:103430301-103430323 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1195295387 X:103471561-103471583 AATAACCAAAGCAGTTTCTCTGG + Intergenic
1195326450 X:103762399-103762421 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1195841823 X:109182843-109182865 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1196073406 X:111548348-111548370 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1196165865 X:112535035-112535057 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1196220655 X:113110004-113110026 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1196300356 X:114044711-114044733 AATCAGCCAAGCACTTTTTCAGG + Intergenic
1196341398 X:114602582-114602604 AATCAGCCAAGCAGTTTTTCGGG - Intronic
1196497220 X:116335550-116335572 AATCACCCAAGCAGTTTTTCAGG + Intergenic
1196533232 X:116813775-116813797 AAACAGCCAAGCAGTTTTTCAGG - Intergenic
1196572817 X:117283567-117283589 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1196773543 X:119319067-119319089 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1197065229 X:122226461-122226483 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1197351732 X:125390137-125390159 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1197471329 X:126867709-126867731 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1197500147 X:127231765-127231787 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1197579504 X:128263914-128263936 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1197622098 X:128762377-128762399 AATGCCCCACGGAGTTTCTCAGG - Intergenic
1197933418 X:131716492-131716514 AATCAGCCAAGCATTTTTTCAGG + Intergenic
1198026385 X:132711747-132711769 AATTAACAAAGCTGTTTCTCTGG - Intronic
1198411395 X:136373093-136373115 AATCAGCCAAGCACTGTTTCAGG + Intronic
1198598770 X:138263228-138263250 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1198599077 X:138265607-138265629 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1198966360 X:142231749-142231771 AATCAGCCAAGCAGTTTCTCAGG + Intergenic
1198983393 X:142424641-142424663 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1199073388 X:143503811-143503833 AATCACCCAAGCAGTTTCTTAGG - Intergenic
1199576797 X:149320079-149320101 AATCAGCCAAGCAGTTTTTCAGG + Intergenic
1199848750 X:151710407-151710429 AAAAACCCATGCAGCTTCTCAGG + Intergenic
1200007356 X:153096339-153096361 AATCACCCAAGCAATTTCTCAGG - Intergenic
1200532535 Y:4356695-4356717 AATCAGCCAAGCAGTTTTTCAGG - Intergenic
1200926428 Y:8658922-8658944 ACGCAGCCCAGCAGTTTCTCAGG - Intergenic
1201233854 Y:11891653-11891675 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1201307148 Y:12560820-12560842 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1201473220 Y:14355664-14355686 AATCACCCAAGCAGTTTTTCAGG - Intergenic
1201724444 Y:17137560-17137582 AATCACCCAAGCAGTTTCTCAGG - Intergenic
1201891365 Y:18947075-18947097 AATCGCCCAAGCAGTTTCTCAGG - Intergenic
1201937551 Y:19424388-19424410 AATCACCCAAGCAGTTTCTCAGG + Intergenic
1202062644 Y:20903822-20903844 AATCACCCAAGTAGTTTCTCAGG - Intergenic